Analysis in progress
Initialising…
0%
complete
This report is still being assembled — sections appear as each stage finishes. It isn't final yet.
RAD54L
Final classification
VUS
RAD54L c.1093_1169+15dup · p.?
RAD54L

PP3 (Supporting): SpliceAI predicts a novel donor splice site with max delta 0.96, above the >=0.8 'very likely' splice-altering threshold.

Gene
RAD54L
Transcript
NM_003579.4
HGVS · transcript:coding
NM_003579.4:c.1093_1169+15dup
Consequence
N/A
GRCh38
chr1:46270708 T>TCGAGACGCTGCTGCTAGTGAGGCAGACAGGCAGCTAGGAGAGGAGCGGCTGCGGGAGCTCACCAGCATTGTGAATAGGTAATGACCTTAAGC
GRCh37
chr1:46736380 T>TCGAGACGCTGCTGCTAGTGAGGCAGACAGGCAGCTAGGAGAGGAGCGGCTGCGGGAGCTCACCAGCATTGTGAATAGGTAATGACCTTAAGC
Basis VUS: the only met criteria conflict — PP3 supporting (SpliceAI max delta 0.96) versus BS1 strong (population AF 0.33–0.88% vs the 0.3% threshold) — matching no ACMG/AMP combination rule.
VUS: the only met criteria conflict — PP3 supporting (SpliceAI max delta 0.96) versus BS1 strong (population AF 0.33–0.88% vs the 0.3% threshold) — matching no ACMG/AMP combination rule.
Classification rationale
PP3 BS1 VUS
RAD54L c.1093_1169+15dup

PP3 (Supporting): SpliceAI predicts a novel donor splice site with max delta 0.96, above the >=0.8 'very likely' splice-altering threshold. BS1 (Strong): allele frequency exceeds the 0.3% threshold in East Asian (0.734%) and South Asian (0.471%) populations, with 6 homozygotes in gnomAD v4.1. The combination of 1 supporting pathogenic criterion (PP3) with 1 strong benign criterion (BS1) is conflicting evidence that matches no benign, likely benign, likely pathogenic, or pathogenic threshold; the variant is classified as Variant of Uncertain Significance (VUS).

PP3 + BS1 VUS
Gene diagram · NM_003579.4 · variants mapped to exon structure
RAD54L NM_003579.4
Fetching transcript structure from UCSC…
Applied criteria · 2 applied · 20 assessed
Applied · 2
Strength Supporting Moderate Strong Very strong
PP3 supporting Pathogenic
Met (supporting): SpliceAI predicts a donor splice-site gain with max delta 0.96, above the >=0.8 'very likely' splice-altering threshold.
SpliceAI Lookup (source_registry key 'spliceai'): DS_AG=0.0, DS_AL=0.02, DS_DG=0.96, DS_DL=0.41, DP_DG=0, DP_DL=77, max_delta_score=0.96.SpliceAI threshold: score >=0.8 = 'very likely' splice-altering, >=0.5 = 'likely', >=0.2 = 'possible' (Jaganathan et al., Cell 2019;176(3):535-548, PMID 30661751). With max delta 0.96 >= 0.8, the prediction supports PP3.Generic ACMG/AMP PP3 definition: computational evidence including splicing impact supports a deleterious effect on the gene or gene product (Richards et al. 2015, Genet Med 17(5):405-424, PMID 25741868; framework file output/generic_acmg_classification_rules.md).
BS1 strong Benign
Met (strong): East Asian (0.734%) and South Asian (0.471%) allele frequencies exceed the 0.3% threshold, with 6 homozygotes in gnomAD v4.1. Confidence is moderate because RAD54L disease prevalence and penetrance are not established.
gnomad_v4: East Asian AF 0.734% (326/44,406) and South Asian AF 0.471% (422/89,650) both exceed 0.3%; grpmax FAF 0.669%; 6 homozygotes (EAS 4, SAS 1, remaining 1)gnomad_canada: South Asian AF 0.884% (12/1,358) and East Asian AF 0.754% (10/1,326) exceed 0.3%gnomad_v2: East Asian AF 0.333% (65/19,546) just exceeds 0.3%; 1 homozygote
Assessed · not applied
Pathogenic
PVS1 Not met: the protein consequence is unknown (NP_003570.2:p.?) and no RNA or functional data confirm the predicted frameshift or loss of function.
PS2 Not assessed: no proband or parental-testing data were available to establish a confirmed de novo occurrence.
PS3 Not assessed: no functional studies of this exact variant exist; an in silico splice prediction (SpliceAI 0.96) cannot substitute for a validated assay.
PS4 Not assessed: no case-control or affected-cohort prevalence data were available for this variant.
PM2 Not met: the highest population allele frequency (South Asian 0.884%, East Asian 0.734%) far exceeds the 0.1% rarity threshold, and homozygotes are observed.
PM3 Not assessed: no proband or family genotype data were available to determine trans phase with a pathogenic variant.
PM4 Not met: no in-frame change is established; retaining the 92-bp duplication (not a multiple of 3) would cause a frameshift, not an in-frame insertion.
PM6 Not assessed: no proband or parental-testing data were available to support an assumed de novo occurrence.
PP1 Not assessed: no affected-family segregation data were available.
PP4 Not assessed: no proband phenotype or family-history data were available.
PP5 Not met: the sole ClinVar submission is a single laboratory's 'Likely benign'; no expert-panel pathogenic classification exists.
Benign
BA1 Not met: maximum allele frequency (0.884%, South Asian) is below the 1% BA1 threshold.
BS2 Not met: RAD54L is only a putative adult-onset cancer-susceptibility candidate, so the full-penetrance early-onset requirement is not satisfied despite 6 gnomAD homozygotes.
BS3 Not assessed: no functional studies demonstrating a benign (non-damaging) effect were available.
BS4 Not assessed: no affected-family non-segregation data were available.
BP2 Not assessed: no cis/trans phase data relative to a pathogenic variant were available.
BP3 Not met: the predicted outcomes are a normal transcript or a frameshift, and exon 10 is not a functionally inert repeat region.
BP4 Not met: the only computational evidence strongly predicts splice impact (SpliceAI max delta 0.96), the opposite of a benign prediction.
BP5 Not assessed: no case data on an alternative molecular basis of disease were available.
BP6 Not met: the 'Likely benign' label comes from a single laboratory, not an expert panel, so it cannot trigger BP6.
N/A · 6 PS1 · PM1 · PM5 · PP2 · BP1 · BP7
Research & evidence
Population frequency
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
This variant is present in gnomAD v4.1 (AF= 0.000493167; MAF= 0.04932%, 795/1612030 alleles, homozygotes = 6) and has highest observed frequency in the East Asian population (AF= 0.00734135; MAF= 0.73414%, 326/44406 alleles, homozygotes = 4); grpmax FAF= 0.00668501.
v2.1
This variant is present in gnomAD v2.1 (AF= 0.000397499; MAF= 0.03975%, 112/281762 alleles, homozygotes = 1) and has highest observed frequency in the East Asian population (AF= 0.00332549; MAF= 0.33255%, 65/19546 alleles, homozygotes = 1); grpmax FAF= 0.00270253.
🇨🇦 CA
This variant is present in gnomAD-Canada v1.0 (AF= 0.0011952624144300772, 22/18406 alleles, homozygotes = 0).
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
0.049% · 795 / 1,612,030
6 hom · FAF 0.67%
East Asian
326 / 44,406
0.73%
4 hom
South Asian
422 / 89,650
0.47%
1 hom
Remaining individuals
34 / 62,310
0.055%
1 hom
African/African American
5 / 75,024
0.0067%
Admixed American
2 / 60,016
0.0033%
European (non-Finnish)
6 / 1,180,008
0.00051%
+ 4 not observed (European (Finnish), Amish, Middle Eastern, Ashkenazi Jewish)
gnomAD v2.1
0.04% · 112 / 281,762
1 hom · FAF 0.27%
East Asian
65 / 19,546
0.33%
1 hom
South Asian
46 / 29,960
0.15%
Remaining individuals
1 / 7,212
0.014%
+ 5 not observed (African/African American, Admixed American, Ashkenazi Jewish, European (Finnish), European (non-Finnish))
gnomAD Canada 🇨🇦
0.12% · 22 / 18,406
0 hom · FAF 0.51%
indel · split
South Asian
12 / 1,358
0.88%
East Asian
10 / 1,326
0.75%
+ 7 not observed (African/African American, Latino/Admixed American, Ashkenazi Jewish, European (Finnish), Middle Eastern, European (non-Finnish), Remaining individuals)
ClinVar screenshot
ClinVar
This variant has been reported in ClinVar as Likely benign (1 clinical laboratory). (ClinVarID = 4281005)
SpliceAI screenshot
In silico
SpliceAI predicts possible splice impact for this variant (max delta score = 0.96).
Functional No data
No calibrated functional assay or RNA evidence was identified for this variant.
OncoKB ↗
COSMIC screenshot
COSMIC
Somatic evidence
COSMIC
This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant does not lie in a statistically significant cancer hotspot.
COSMIC ↗
Sources & reference links
7Sources
ClinVar
gnomAD v2.1
gnomAD v4.1
gnomAD-Canada
SpliceAI
OncoKB
COSMIC