Analysis in progress
Initialising…
0%
complete
This report is still being assembled — sections appear as each stage finishes. It isn't final yet.
PTEN
Final classification
VUS
PM2
PTEN
c.129_155del
p.Glu43_Asp51del
inframe deletion
This variant

NM_000314.8:c.129_155del (NP_000305.3:p.(Glu43_Asp51del)) is an in-frame deletion of nine amino acids in exon 2 of PTEN.

Transcript
NM_000314.8
HGVS · transcript:coding
NM_000314.8:c.129_155del
GRCh38
chr10:87894070 TTGAAGGCGTATACAGGAACAATATTGA>T
GRCh37
chr10:89653827 TTGAAGGCGTATACAGGAACAATATTGA>T
Basis ClinGen PTEN Expert Panel Specifications to the ACMG/AMP Variant Interpretation Guidelines for PTEN Version 3.2 v3.2 criteria-combination framework was evaluated deterministically with applied criteria: PM2 supporting; no rule matched the adjudicated criteria.
ClinGen PTEN Expert Panel Specifications to the ACMG/AMP Variant Interpretation Guidelines for PTEN Version 3.2 v3.2 criteria-combination framework was evaluated deterministically with applied criteria: PM2 supporting; no rule matched the adjudicated criteria.
Classification rationale
PM2 VUS
PTEN c.129_155del inframe deletion

NM_000314.8:c.129_155del (NP_000305.3:p.(Glu43_Asp51del)) is an in-frame deletion of nine amino acids in exon 2 of PTEN.1 The variant is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada, meeting the PTEN Expert Panel threshold for PM2_Supporting.2 The variant is absent from ClinVar, and no proband, de novo, or co-segregation data are available.3 The deleted residues Glu43-Asp51 lie outside the PTEN catalytic motifs (90-94, 123-130, 166-168), so PM1 and PM4 are not met, and the in-frame deletion is not a null variant for PVS1.4 The exact 9-residue deletion was not assayed in the Mighell et al. saturation mutagenesis data, so PS3 is not met; single-amino-acid deletions at Glu43 and Asp51 are strongly damaging but do not directly test the multi-residue deletion.5 Overall, only PM2_Supporting is met, which is insufficient to reach Likely Pathogenic under the PTEN Expert Panel combination rules; the variant is classified as a Variant of Uncertain Significance.6

PM2 VUS
5 vcep_mmc2
6 final_classification_framework
Gene diagram · NM_000314.8 · variants mapped to exon structure
PTEN NM_000314.8
Fetching transcript structure from UCSC…
Applied criteria · 1 applied · 17 assessed
MetEvidence satisfies this criterion.
Not metEvaluated against available evidence; threshold not reached.
Not assessedApplies in principle, but no evidence was found to evaluate it.
N/ADoesn't apply to this variant type.
Applied · 1
Strength Supporting Moderate Strong Very strong
PM2 supporting review Pathogenic
The variant is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada, meeting the PTEN EP threshold for PM2_Supporting (allele frequency <0.001%).
Absent from gnomAD v2.1 (exome).Absent from gnomAD v4.1 (exome).Absent from gnomAD-Canada v1.0 (AC 0
Assessed · not applied · 17 not met · 0 not assessed
Pathogenic
PS1 No previously established pathogenic variant with the same amino acid change (p.Glu43_Asp51del) is reported; the variant is absent from ClinVar.
PS2 No de novo observation (with maternity and paternity confirmed) has been reported for this variant.
PS3 The PTEN EP PS3_Moderate rule requires locating the variant in the Mighell et al.
PS4 The variant is absent from ClinVar with no affected probands, so prevalence in affected individuals cannot be assessed.
PM1 The deleted residues (Glu43-Asp51) lie in the N-terminal region and are outside the PTEN catalytic motifs defined for PM1 (WPD loop 90-94, P-loop 123-130, TI-loop 166-168).
PM4 Although this is an in-frame deletion in a non-repeat region, the PTEN EP PM4 specification limits application to in-frame insertions/deletions impacting at least one catalytic-motif residue; residues Glu43-Asp51 are outside those motifs (90-94, 123-130, 166-168).
PM6 No assumed de novo observation (without confirmation of paternity/maternity) has been reported for this variant.
PP1 No co-segregation data in affected family members is available for this variant.
PP3 PP3 requires multiple concordant lines of computational evidence (REVEL >0.7 for missense, or SpliceAI plus VarSeak concordance for splicing); REVEL is unavailable for this non-SNV and VarSeak was not run, so the requirement is not satisfied.
Benign
BA1 The variant is absent from gnomAD, so the filtering allele frequency threshold for BA1 (>0.056%) is not met.
BS1 The variant is absent from gnomAD, so the BS1 allele frequency range (0.0043%-0.056%) is not met.
BS2 The variant has not been observed in the homozygous state in a healthy or PHTS-unaffected individual.
BS3 No functional study demonstrates a benign effect on protein function; the exact deletion is not in the Mighell saturation mutagenesis table.
BS4 No data on lack of segregation in affected family members is available.
BP2 No observation of this variant in trans or in cis with a pathogenic/likely pathogenic PTEN variant has been reported.
BP4 Computational evidence does not suggest no impact; SpliceAI predicts possible donor loss (max delta 0.617), and no REVEL score is available, so BP4 is not supported.
BP5 No case with an alternate molecular basis for disease has been identified for this variant.
N/A · 10 PVS1 · PM3 · PM5 · PP2 · PP4 · PP5 · BP1 · BP3 · BP6 · BP7
Research & evidence
Population frequency
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
Absent from gnomAD v4.1.
v2.1
Absent from gnomAD v2.1.
🇨🇦 CA
Absent from gnomAD-Canada v1.0.
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD v2.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD Canada 🇨🇦
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
ClinVar screenshot
ClinVar
This variant is absent from ClinVar.
SpliceAI screenshot
In silico
SpliceAI predicts possible splice impact for this variant (max delta score = 0.62).
Functional / OncoKB screenshot
Functional Unknown Oncogenic Effect
OncoKB did not identify variant-specific reviewed functional evidence for this variant; gene-level curated context is available for reviewer follow-up. PTEN, a lipid and protein phosphatase, is one of the most frequently mutated genes in cancer.
OncoKB ↗
COSMIC screenshot
COSMIC
Cancer hotspots screenshot
Cancer hotspots
Somatic evidence Not in COSMIC / hotspots
COSMIC
This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant does not lie in a statistically significant hotspot.
Sources & reference links
9Sources
CSpec VCEP
ClinVar
gnomAD v2.1
gnomAD v4.1
gnomAD-Canada
SpliceAI
OncoKB
COSMIC
Cancer hotspots