BARD1

Final classification

Likely Pathogenic

PVS1PM2

BARD1

c.1935_1954dup

p.Glu652ValfsTer69

frameshift · exon 10

Gene context NCBI Gene ↗ OncoKB ↗

BARD1 encodes a protein that partners with BRCA1 to form a complex essential for repairing damaged DNA, particularly double-stranded breaks, and for maintaining genome stability through cell-cycle checkpoints and chromatin regulation. Germline mutations in BARD1 predispose to breast and ovarian cancer, among other cancers, and the gene is generally regarded as a tumor suppressor, although some evidence suggests it can also promote cancer in certain cellular contexts.

This variant

BARD1 partners with BRCA1 to repair double-stranded DNA breaks, and germline mutations predispose to breast and ovarian cancer. This Likely Pathogenic frameshift removes part of the BRCT domain required for that repair function, so it is expected to impair BARD1's tumor-suppressor activity and confer cancer predisposition.

Transcript

NM_000465.4

HGVS · transcript:coding

NM_000465.4:c.1935_1954dup

GRCh38

chr2:214730457 T>TCATACTTTTCTTCCTGTTCA

GRCh37

chr2:215595181 T>TCATACTTTTCTTCCTGTTCA

Basis With no BARD1-specific gene framework available, generic ACMG/AMP 2015 rules were used: one strong (PVS1) plus one moderate (PM2) pathogenic criterion yields Likely Pathogenic. ▾

With no BARD1-specific gene framework available, generic ACMG/AMP 2015 rules were used: one strong (PVS1) plus one moderate (PM2) pathogenic criterion yields Likely Pathogenic.

Classification rationale

PVS1PM2 Likely Pathogenic

BARD1 c.1935_1954dup frameshift · exon 10

PVS1 (Strong): truncating frameshift p.(Glu652ValfsTer69) escapes NMD but deletes the second BRCT domain, a critical functional region. PM2 (Moderate): rare in gnomAD, with maximum subpopulation allele frequency 0.0001178, no homozygotes, and absence from gnomAD-Canada. Likely Pathogenic: combination of one strong (PVS1) plus one moderate (PM2) pathogenic criterion.

PVS1 + PM2 → Likely Pathogenic

Gene diagram · NM_000465.4 · variants mapped to exon structure

BARD1 NM_000465.4

Fetching transcript structure from UCSC…

Applied criteria · 2 applied · 16 assessed

MetEvidence satisfies this criterion.

Not metEvaluated against available evidence; threshold not reached.

Not assessedApplies in principle, but no evidence was found to evaluate it.

N/ADoesn't apply to this variant type.

Applied · 2

Strength Supporting Moderate Strong Very strong

✓

PVS1 strong Pathogenic

Met (Strong): truncating frameshift p.(Glu652ValfsTer69) escapes NMD but removes the second BRCT domain, a critical functional region.

No BARD1 CSPEC/VCEP or local explicit PVS1 framework was available; generic ACMG/AMP assessment follows the ClinGen SVI PVS1 recommendations (PMC6185798).VariantValidator normalization identifies NM_000465.4 as MANE Select and RefSeq Select. c.1935_1954dup lies in exon 10; the predicted p.(Glu652ValfsTer69) product ends at residue 720, whereas the reference product extends to residue 778. The terminal coding exon begins at c.2002, placing the predicted premature stop in the terminal exon and supporting NMD escape.The gene-level PVS1 context identifies BARD1 loss of function as an established germline disease mechanism and marks the gene eligible for generic PVS1 assessment.

pvs1_generic_framework ↗PMID:26738429 ↗PMID:17848578 ↗

✓

PM2 moderate Pathogenic

Met (Moderate): essentially absent from population databases, with maximum subpopulation allele frequency 0.0001178 and no homozygotes.

gnomAD v4.1: 146/1,614,002 alleles, AF 9.04584e-05; highest reported subpopulation AF 139/1,179,966 (0.0001178) in European non-Finnish individuals; homozygotes = 0.gnomAD v2.1: 17/282,768 alleles, AF 6.012e-05; highest reported subpopulation AF 15/129,114 (0.000116176) in European non-Finnish individuals; homozygotes = 0.gnomAD-Canada v1.0 reports the variant as absent.

gnomad_v2 ↗gnomad_v4 ↗gnomad_canada ↗

Assessed · not applied · 2 not met · 14 not assessed

Pathogenic

PS2 Not assessed: no de novo observation with confirmed parentage was documented.

PS3 Not assessed: no validated functional assay of this exact variant was available.

PS4 Not assessed: no case-control enrichment statistic for this exact variant was available.

PM3 Not assessed: no evidence of a second pathogenic variant in trans or a recessive inheritance pattern.

PM6 Not assessed: no assumed de novo occurrence with parental information was documented.

PP1 Not assessed: no segregation data for this exact variant were available.

PP4 Not assessed: breast/ovarian cancer phenotype is not specific enough to BARD1 to qualify as a highly specific presentation.

PP5 Not assessed: no ClinVar expert-panel submission exists for this exact variant.

Benign

BA1 Not met: maximum allele frequency 0.0001178 versus the 5% stand-alone benign threshold.

BS1 Not met: maximum allele frequency 0.0001178 is far below the frequency expected for a benign BARD1 variant.

BS2 Not assessed: no observations in healthy adults or healthy homozygotes were documented.

BS3 Not assessed: no functional assay showing preserved normal function of this variant was available.

BS4 Not assessed: no non-segregation or unaffected-relatives observations were documented.

BP2 Not assessed: no phase or co-occurrence data for this variant were available.

BP5 Not assessed: no observation alongside an independent molecular diagnosis explaining the phenotype was documented.

BP6 Not assessed: no ClinVar expert-panel benign assertion exists for this exact variant.

N/A · 10 PS1 · PM1 · PM4 · PM5 · PP2 · PP3 · BP1 · BP3 · BP4 · BP7

Research & evidence

Population frequency · supports pathogenic

gnomAD v4.1

gnomAD v2.1

v4.1

This variant is present in gnomAD v4.1 (AF= 9.04584e-05; MAF= 0.00905%, 146/1614002 alleles, homozygotes = 0) and has highest observed frequency in the European (non-Finnish) population (AF= 0.0001178; MAF= 0.01178%, 139/1179966 alleles, homozygotes = 0); grpmax FAF= 0.0001016.

v2.1

This variant is present in gnomAD v2.1 (AF= 6.012e-05; MAF= 0.00601%, 17/282768 alleles, homozygotes = 0) and has highest observed frequency in the European (non-Finnish) population (AF= 0.000116176; MAF= 0.01162%, 15/129114 alleles, homozygotes = 0); grpmax FAF= 8.103e-05.

🇨🇦 CA

Absent from gnomAD-Canada v1.0.

Allele frequency by ancestry

three datasets · side by side

gnomAD v4.1

0.009% · 146 / 1,614,002
0 hom · FAF 0.01%

European (non-Finnish) 139 / 1,179,966	0.012%
African/African American 3 / 75,038	0.004%
Remaining individuals 2 / 62,500	0.0032%
European (Finnish) 2 / 64,010	0.0031%

+ 6 not observed (Admixed American, Amish, East Asian, Middle Eastern, South Asian, Ashkenazi Jewish)

gnomAD v2.1

0.006% · 17 / 282,768
0 hom · FAF 0.0081%

European (non-Finnish) 15 / 129,114	0.012%
European (Finnish) 2 / 25,102	0.008%

+ 6 not observed (African/African American, Admixed American, Ashkenazi Jewish, East Asian, Remaining individuals, South Asian)

gnomAD Canada 🇨🇦

Absent · 0 / ?
0 hom

Not observed in any ancestry group.

gnomAD v4 ↗ gnomAD v2 ↗ gnomAD 🇨🇦 ↗

ClinVar

This variant has been reported in ClinVar as Pathogenic (13 clinical laboratories) and as Likely pathogenic (4 clinical laboratories). (ClinVarID = 127725)

ClinVar ↗

In silico

SpliceAI predicts no significant splice impact for this variant (max delta score = 0.00).

SpliceAI ↗

Functional Likely Oncogenic

OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Loss-of-function; curated oncogenicity label: Likely Oncogenic.

OncoKB ↗

COSMIC

Cancer hotspots

Somatic evidence Not in COSMIC / hotspots

COSMIC

This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).

Hotspots

This variant does not lie in a statistically significant hotspot.

COSMIC ↗ Hotspots ↗

Literature · how each cited paper was used

2papers cited

Each card is an audit: what was searched, what was found, whether it names the variant, which criteria it fed, and why. 6 further PMIDs triaged but not cited — see Sources & references.

New concepts on BARD1: Regulator of BRCA pathways and beyond.

PMID 26738429 ↗ · Irminger-Finger I et al. · 2016 Mar CLINVAR · splicing rna

Searched

c.1935_1954dupNP_000456.2:p.(E652Vfs*69)p.E652Vfs*69

Found

In a screening study of 196 non-BRCA1/2 breast or ovarian cancer families, the paper reports the exact BARD1 frameshift duplication c.1935_1954dup, resulting in p.E652Vfs*69. It states that this variant causes a premature stop and loss of BARD1's second BRCT domain.

Variant

✓ Names this variant — characterised directly

Applied to

→PVS1 strong

Directly identifies the queried frameshift as causing premature termination and loss of the second BRCT domain.

The screening of 196 non-BRCA1/2 breast or ovarian cancer families for BARD1 germline mutations identified eleven intron variants and fifteen exon variants, comprising nine missense mutations, four silent mutations, one in-frame deletion and one frame-shift duplication (c.1935_1954dup; p.E652Vfs*69) causing a premature stop and loss of the second BRCT domain of BARD1 (De Brakeleer et al., 2010).

Location Section 7.1.1.1, page 16 · Context Screening of 196 non-BRCA1/2 breast or ovarian cancer families for germline BARD1 mutations; exon and intron variant identification. · full text

Rule & framework references · cited for criterion definitions, not variant evidence

17848578 ↗ Structural requirements for the BARD1 tumor suppressor in chromosomal stability and homology-directed DNA repair.

Sources & reference links

8Sources

ClinVar

gnomAD v2.1

gnomAD v4.1

gnomAD-Canada

SpliceAI

OncoKB

COSMIC

Cancer hotspots

Triaged references · 6 PMIDs not cited in assessment

20029420 ↗ BRCA1 and its toolbox for the maintenance of genome integrity. ONCOKB

8944023 ↗ Identification of a RING protein that can interact in vivo with the BRCA1 gene product. ONCOKB

17550235 ↗ Crystal structure of the BARD1 BRCT domains. CLINVAR

21344236 ↗ Cancer predisposing BARD1 mutations in breast-ovarian cancer families. CLINVAR

25741868 ↗ Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. CLINVAR

26467025 ↗ A Standardized DNA Variant Scoring System for Pathogenicity Assessments in Mendelian Disorders. CLINVAR