Back
NM_001127500.2:c.3073_3082+25del
p.? · MET
ACMG/AMP
0%
complete
Final classification
VUS
PM2PP3
MET
c.3073_3082+25del
p.?
unknown · exon 14-14i
Gene context NCBI Gene ↗ OncoKB ↗

MET encodes a receptor tyrosine kinase that serves as the cell-surface receptor for hepatocyte growth factor (HGF). Upon HGF binding, the receptor activates signaling pathways that promote cell growth, survival, movement, and blood vessel formation, and it plays important roles in embryonic development and tissue repair. Mutations in MET are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers, and amplification or overexpression of the gene is found in many human cancers, where it can drive tumor growth and spread.

This variant

This splice-region deletion lies in MET, which encodes the HGF receptor tyrosine kinase that regulates cell growth, survival, movement, and tissue repair.

Transcript
NM_001127500.2
HGVS · transcript:coding
NM_001127500.2:c.3073_3082+25del
GRCh38
chr7:116771979 TTTTCCAGAAGGTATATTTCAGTTTATTGTTCTGAG>T
GRCh37
chr7:116412033 TTTTCCAGAAGGTATATTTCAGTTTATTGTTCTGAG>T
VUS: PM2 (supporting) plus PP3 (moderate) provide limited evidence, but no generic ACMG combination threshold for Likely Pathogenic or Pathogenic is met.
Classification rationale
PM2PP3 VUS
MET c.3073_3082+25del unknown · exon 14-14i

PM2 supporting: the exact variant is absent from gnomAD v2.1 and v4.1. PP3 moderate: SpliceAI maximum delta 0.943 exceeds the generic splice-impact threshold of 0.5.

PM2 + PP3 → VUS
LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
Gene diagram · NM_001127500.2 · variants mapped to exon structure
MET NM_001127500.2
Fetching transcript structure from UCSC…
Applied criteria · 2 applied · 18 assessed
MetEvidence satisfies this criterion.
Not metEvaluated against available evidence; threshold not reached.
Not assessedApplies in principle, but no evidence was found to evaluate it.
N/ADoesn't apply to this variant type.
Applied · 2
Strength Supporting Moderate Strong Very strong
PM2 supporting Pathogenic
Met at supporting strength: the variant is absent from gnomAD v2.1 and v4.1 (observed frequency 0), below the PM2 threshold of <=0.0001.
No applicable MET-specific VCEP/CSPEC was available; the supplied generic PM2 threshold is allele frequency <=0.0001 at supporting strength.gnomAD v2.1 reports the exact variant as absent, corresponding to observed frequency 0.gnomAD v4.1 reports the exact variant as absent, corresponding to observed frequency 0.
gnomad_v2 ↗gnomad_v4 ↗
PP3 moderate Pathogenic
Met: SpliceAI maximum delta 0.943 exceeds the generic PP3 moderate threshold of 0.5 for splice-impact prediction.
The variant is NM_001127500.2:c.3073_3082+25del, an intronic/splice-region deletion with protein consequence p.?, so PP3 is evaluated through SpliceAI rather than missense predictors.SpliceAI maximum delta score is 0.943 (DS_DL), exceeding the supplied PP3 moderate cutoff of >=0.5.The supplied cutoff is the SpliceAI high-precision cutoff from Jaganathan et al. 2019 (PMID:30661751).
spliceai ↗
Assessed · not applied · 5 not met · 13 not assessed
Pathogenic
PVS1 Not assessed: the deletion spans exon 14 into intron 14i, but its molecular consequence and protein effect are unresolved despite SpliceAI max delta 0.943.
PS2 Not assessed: no proband-level parental testing or confirmed de novo status is documented.
PS3 Not assessed: no validated MET functional assay was identified; SpliceAI max delta 0.943 is computational evidence, not PS3 assay evidence.
PS4 Not assessed: no case-control cohort or exact-variant prevalence/enrichment statistic was available to evaluate PS4.
PM3 Not assessed: no affected-proband, phase, trans-variant, or inheritance observations are documented for this variant.
PM6 Not assessed: no apparently de novo occurrence without confirmed maternity and paternity is documented.
PP1 Not assessed: no affected relatives or informative cosegregating meioses are documented.
PP4 Not assessed: no documented phenotype or disease-specific clinical presentation for a carrier of this exact MET variant was available.
PP5 Not met: ClinVar has no exact-variant record or expert-panel Pathogenic/Likely pathogenic classification for c.3073_3082+25del.
Benign
BA1 Not met: the variant is absent from gnomAD v2.1 and v4.1 (observed frequency 0), far below the generic BA1 threshold of >=0.05.
BS1 Not met: gnomAD v2.1 and v4.1 show zero observed alleles for the variant, below the generic BS1 threshold of allele frequency >=0.01.
BS2 Not assessed: no healthy homozygote or carrier-phenotype observation is available to evaluate the BS2 requirement.
BS3 Not assessed: no validated benign functional assay was identified, and SpliceAI max delta 0.943 predicts possible splice impact rather than normal function.
BS4 Not assessed: no informative unaffected relatives tested negative for the variant are documented.
BP2 Not assessed: no cis/trans phase, pathogenic-partner, affected-status, or inheritance observations are documented for this variant.
BP4 Not met: SpliceAI maximum delta 0.943 is above the generic BP4 supporting threshold of 0.1.
BP5 Not assessed: no confirmed alternative molecular cause or BP5-specific likelihood-ratio value and threshold was available.
BP6 Not met: ClinVar has no exact-variant record or expert-panel Benign/Likely benign classification for c.3073_3082+25del.
N/A · 8 PS1 · PM1 · PM4 · PM5 · PP2 · BP1 · BP3 · BP7
Research & evidence
Population frequency
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
Absent from gnomAD v4.1.
v2.1
Absent from gnomAD v2.1.
🇨🇦 CA
Not available in gnomAD-Canada v1.0.
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD v2.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD Canada 🇨🇦
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD v4 ↗ gnomAD v2 ↗ gnomAD 🇨🇦 ↗
ClinVar screenshot
ClinVar
This variant is absent from ClinVar.
ClinVar ↗
SpliceAI screenshot
In silico
SpliceAI predicts possible splice impact for this variant (max delta score = 0.94).
SpliceAI ↗
Functional No data
No calibrated functional assay or RNA evidence was identified for this variant.
OncoKB ↗
COSMIC screenshot
COSMIC
Somatic evidence
COSMIC
This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant does not lie in a statistically significant cancer hotspot.
COSMIC ↗
Sources & reference links
7Sources
ClinVar
gnomAD v2.1
gnomAD v4.1
gnomAD-Canada
SpliceAI
OncoKB
COSMIC