Back
NM_000314.8:c.165-10_209+6del
p.? · PTEN
0%
complete
Final classification
VUS
PVS1PM2
PTEN
c.165-10_209+6del
p.?
unknown · exon 2i-3i

PTEN is a tumor suppressor gene that encodes a phosphatase converting the lipid messenger PIP3 back to PIP2 at the cell membrane, thereby restraining the AKT/mTOR signaling pathway that drives cell growth, proliferation, and survival. It is one of the most frequently mutated genes across many types of human cancer, and its loss promotes unchecked cell growth, survival, and genomic instability, partly through impaired DNA repair. Germline loss-of-function variants in PTEN cause Cowden syndrome, an inherited cancer predisposition disorder associated with elevated risk of breast and thyroid cancer.

This variant

This PTEN loss-of-function variant is relevant to Cowden syndrome because germline PTEN loss disrupts tumor-suppressive control of AKT/mTOR signaling and increases cancer predisposition.

Transcript
NM_000314.8
HGVS · transcript:coding
NM_000314.8:c.165-10_209+6del
GRCh38
chr10:87925501 TTTTGTTTTAAGGTTTTTGGATTCAAAGCATAAAAACCATTACAAGATATACAATCTGTAAG>T
GRCh37
chr10:89685258 TTTTGTTTTAAGGTTTTTGGATTCAAAGCATAAAAACCATTACAAGATATACAATCTGTAAG>T
VUS: PVS1 (strong) plus PM2 (supporting) do not satisfy any ClinGen PTEN Expert Panel Version 3.2 pathogenic or likely pathogenic combination rule.
Classification rationale
PVS1PM2 VUS
PTEN c.165-10_209+6del unknown · exon 2i-3i

PVS1 strong: the PTEN decision tree assigns strong loss-of-function evidence to this in-frame single-exon 3 deletion. PM2 supporting: the variant is absent from gnomAD v2.1 and v4.1.

PVS1 + PM2 VUS
LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
Gene diagram · NM_000314.8 · variants mapped to exon structure
PTEN NM_000314.8
Fetching transcript structure from UCSC…
Applied criteria · 2 applied · 13 assessed
MetEvidence satisfies this criterion.
Not metEvaluated against available evidence; threshold not reached.
Not assessedApplies in principle, but no evidence was found to evaluate it.
N/ADoesn't apply to this variant type.
Applied · 2
Strength Supporting Moderate Strong Very strong
PVS1 strong Pathogenic
Met, strong: the PTEN tree assigns strong PVS1 to an in-frame single-exon 3 deletion, with a 45-nucleotide coding deletion and SpliceAI maximum delta 0.996.
The PTEN-specific decision tree states that a single exon 3 deletion preserving the reading frame, with exon 3 critical to protein function, receives PVS1_Strong.The normalized variant is NM_000314.8:c.165-10_209+6del, spanning exon 3 and flanking intronic sequence; c.165_209 is a 45-nucleotide coding interval.SpliceAI reports DS_AL 0.976 and DS_DL 0.996, with maximum delta score 0.996, consistent with substantial splice impact.
PM2 supporting Pathogenic
Met at supporting: the variant is absent from gnomAD v2.1 and v4.1, below the PTEN PM2 threshold of 0.00001 allele frequency.
PTEN Expert Panel Version 3.2 specifies PM2 supporting for absence or allele frequency <0.00001 (0.001%) in gnomAD or another large sequenced population; any subpopulation with multiple alleles must be <0.00002 (0.002%).The variant was reported absent from the default all-comers gnomAD v2.1 and gnomAD v4.1 datasets, satisfying the PTEN PM2 supporting threshold.The gnomAD v2.1 and v3.1 non-cancer queries failed, but the PTEN PM2 specification does not require those subsets; the default all-comers datasets were therefore used.
Assessed · not applied · 4 not met · 9 not assessed
Pathogenic
PS2 Not assessed: no documented proband, parental testing, maternity or paternity confirmation, or qualifying de novo observation is available for the PS2 rule.
PS3 Not assessed: the intronic deletion has no governing mmc2 missense-table entry or available variant-specific assay demonstrating abnormal splicing.
PS4 Not assessed: no proband specificity scores or case-control enrichment statistics are available to compare with the PTEN PS4 requirements.
PM4 Not met: the 45-nucleotide in-frame deletion is outside PTEN catalytic motifs 90-94, 123-130, and 166-168 required by the VCEP PM4 rule.
PM6 Not assessed: no presumed de novo observation, proband disease documentation, parental testing, or family-history information is available for PM6.
PP1 Not assessed: no affected relatives, segregation results, or counted meioses are documented, so the PTEN thresholds of 3, 5, or 7 meioses cannot be evaluated.
Benign
BA1 Not met: the variant is absent from gnomAD v2.1 and v4.1, yielding observed frequency 0 versus the PTEN BA1 threshold >0.00056.
BS1 Not met: gnomAD v2.1 and v4.1 show observed frequency 0, below the PTEN BS1 supporting lower bound of 0.0000043.
BS2 Not met: the variant is absent from gnomAD v2.1 and v4.1, providing zero homozygous population observations required by the PTEN BS2 rule.
BS3 Not assessed: no variant-specific RNA or mini-gene assay shows preserved splicing, and the governing missense functional table contains no entry for this intronic deletion.
BS4 Not assessed: no affected variant-negative relatives or family-level non-segregation observations are documented for the one-family or two-family BS4 thresholds.
BP2 Not assessed: no documented cis/trans phase or qualifying co-occurring pathogenic PTEN variant observations are available for the required BP2 rule.
BP5 Not assessed: no two qualifying cases with a highly penetrant alternate diagnosis and non-overlapping PTEN history are documented.
N/A · 13 PS1 · PM1 · PM3 · PM5 · PP2 · PP3 · PP4 · PP5 · BP1 · BP3 · BP4 · BP6 · BP7
Research & evidence
Population frequency
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
Absent from gnomAD v4.1.
v2.1
Absent from gnomAD v2.1.
🇨🇦 CA
Absent from gnomAD-Canada v1.0.
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD v2.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD Canada 🇨🇦
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
ClinVar screenshot
ClinVar
This variant is absent from ClinVar.
SpliceAI screenshot
In silico
SpliceAI predicts possible splice impact for this variant (max delta score = 1.00).
Functional No data
No calibrated functional assay or RNA evidence was identified for this variant.
OncoKB ↗
COSMIC screenshot
COSMIC
Somatic evidence
COSMIC
This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant does not lie in a statistically significant cancer hotspot.
COSMIC ↗
Sources & reference links
8Sources
CSpec VCEP
ClinVar
gnomAD v2.1
gnomAD v4.1
gnomAD-Canada
SpliceAI
OncoKB
COSMIC