Back
NM_000059.4:c.29_63del
p.Thr10SerfsTer9 · BRCA2
0%
complete
Final classification
Pathogenic
PVS1PM5
BRCA2
c.29_63del
p.Thr10SerfsTer9
This variant

The BRCA2 c.29_63del (p.(Thr10SerfsTer9)) variant has not been observed in somatic cancers in COSMIC and has not been reported in ClinVar; OncoKB classifies p.(T10Sfs*9) as Likely Oncogenic with a likely loss-of-function effect.

Transcript
NM_000059.4
HGVS · transcript:coding
NM_000059.4:c.29_63del
GRCh38
chr13:32316486 CAACATTTTTTGAAATTTTTAAGACACGCTGCAACA>C
GRCh37
chr13:32890623 CAACATTTTTTGAAATTTTTAAGACACGCTGCAACA>C
ENIGMA BRCA1 and BRCA2 Specification v1.2 Table 3 criteria-combination framework (official CSPEC/VCEP final-classification framework).
Classification rationale
PVS1PM5 Pathogenic
BRCA2 c.29_63del

The BRCA2 c.29_63del (p.(Thr10SerfsTer9)) variant has not been observed in somatic cancers in COSMIC and has not been reported in ClinVar; OncoKB classifies p.(T10Sfs*9) as Likely Oncogenic with a likely loss-of-function effect.1 This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed allele frequency is 0 in the queried population datasets.2 The deletion causes an early frameshift with premature termination in exon 2, and ENIGMA BRCA2 Table 4 assigns exon 2 protein-truncating variants PVS1 and PM5_Strong (PTC), which supports a loss-of-function disease mechanism for this variant.3 SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.04.4

PVS1 + PM5 Pathogenic
3 cspec ↗pvs1_gene_contextpvs1_variant_assessmentvcep_s_p_e_c_i_f_i_c_a_t_i_o_n_s___t_a_b_l_e_4___v_1___2___2_0_2_4___1_1___1_8
LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
Gene diagram · NM_000059.4 · variants mapped to exon structure
BRCA2 NM_000059.4
Fetching transcript structure from UCSC…
Applied criteria · 2 applied · 13 assessed
MetEvidence satisfies this criterion.
Not metEvaluated against available evidence; threshold not reached.
Not assessedApplies in principle, but no evidence was found to evaluate it.
N/ADoesn't apply to this variant type.
Applied · 2
Strength Supporting Moderate Strong Very strong
PVS1 very strong Pathogenic
This variant is a 35 bp deletion in BRCA2 exon 2 that causes a frameshift and premature termination, p.(Thr10SerfsTer9). Loss of function is an established disease mechanism for BRCA2, and ENIGMA BRCA2 Table 4 assigns exon 2 protein-truncating variants PVS1; this supports PVS1 at very strong strength.
NM_000059.4:c.29_63del is predicted as NP_000050.3:p.(Thr10SerfsTer9)VariantValidator places the deletion in exon 2ENIGMA Table 4 marks BRCA2 exon 2 PTC variants as PVS1
PM5 strong Pathogenic
This variant creates a premature termination codon in BRCA2 exon 2. ENIGMA BRCA2 Table 4 assigns PM5_Strong (PTC) to exon 2 protein-truncating variants when PVS1 is applicable, so this criterion is met at strong strength.
Variant is a frameshift with premature terminationVariant is located in exon 2ENIGMA Table 4 marks BRCA2 exon 2 PTC variants as PM5_Strong (PTC)
Assessed · not applied · 2 not met · 11 not assessed
Pathogenic
PS1 No evidence was identified showing that this variant produces the same amino acid change or the same predicted splice effect as a previously classified pathogenic or likely pathogenic BRCA2 variant.
PS3 No variant-specific calibrated functional study result was identified for NM_000059.4:c.29_63del in the curated ENIGMA functional table, so PS3 cannot be applied from the available evidence.
PS4 No case-control study or quantitative enrichment data were identified showing that this variant is significantly more frequent in affected individuals than in controls, so PS4 is not established.
PM2 This variant is absent from gnomAD v2.1 and gnomAD v4.1, with an observed allele frequency of 0 in the queried datasets.
PM3 No evidence was identified that this variant was observed in trans with another BRCA2 variant in an individual with BRCA2-related Fanconi anemia, so PM3 is not established.
PP1 No segregation data were identified for this variant, so co-segregation evidence supporting pathogenicity was not established.
PP4 No multifactorial likelihood analysis or other quantitative phenotype-specific evidence was identified for this variant, so PP4 was not established.
Benign
BA1 This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed allele frequency is 0 and is below the ENIGMA BA1 threshold of greater than 0.1% (FAF > 0.001).
BS1 This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed allele frequency is 0 and is below the ENIGMA BS1 thresholds of greater than 0.01% for BS1 or greater than 0.002% for BS1_Supporting.
BS2 No evidence was identified showing this variant in individuals lacking features of BRCA2-related Fanconi anemia under the ENIGMA BS2 framework, so BS2 was not established.
BS3 No variant-specific calibrated functional study showing no damaging effect was identified for NM_000059.4:c.29_63del, so BS3 cannot be applied from the available evidence.
BS4 No lack-of-segregation data were identified for this variant, so BS4 was not established.
BP5 No multifactorial likelihood evidence arguing against pathogenicity was identified for this variant, so BP5 was not established.
N/A · 13 PS2 · PM1 · PM4 · PM6 · PP2 · PP3 · PP5 · BP1 · BP2 · BP3 · BP4 · BP6 · BP7
Research & evidence
Population frequency · supports pathogenic
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
Absent from gnomAD v4.1.
v2.1
Absent from gnomAD v2.1.
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD v2.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
ClinVar screenshot
ClinVar
This variant is absent from ClinVar.
SpliceAI screenshot
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.04).
Functional / OncoKB screenshot
Functional Likely Oncogenic
OncoKB classifies this variant as Likely Oncogenic; biological effect: Likely Loss-of-function.
OncoKB ↗
COSMIC screenshot
COSMIC
Cancer hotspots screenshot
Cancer hotspots
Somatic evidence Not in COSMIC / hotspots
COSMIC
This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant does not lie in a statistically significant hotspot.
Sources & reference links
8Sources
CSpec VCEP
ClinVar
gnomAD v2.1
gnomAD v4.1
SpliceAI
OncoKB
COSMIC
Cancer hotspots