Back
NM_000222.2:c.1679_1738delinsATG
p.Val560_His580delinsAspAsp · KIT
ACMG/AMP
0%
complete
Final classification
VUS
PM1PM2PM4
KIT
c.1679_1738delinsATG
p.Val560_His580delinsAspAsp
missense
This variant

NM_000222.2:c.1679_1738delinsATG is an in-frame deletion-insertion in KIT exon 11 resulting in p.Val560_His580delinsAspAsp, which removes a 21-amino-acid segment of the juxtamembrane autoinhibitory domain. PM1 (moderate) is met: the juxtamembrane domain is a well-characterized critical functional domain, and its disruption causes ligand-independent constitutive kinase activation.

Transcript
NM_000222.2
HGVS · transcript:coding
NM_000222.2:c.1679_1738delinsATG
GRCh38
chr4:54727447 TTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCCTTATGATC>ATG
GRCh37
chr4:55593613 TTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCCTTATGATC>ATG
gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PM1 moderate, PM2 supporting, PM4 supporting; combination = 1 moderate + 2 supporting, which maps to VUS.
Classification rationale
PM1PM2PM4 VUS
KIT c.1679_1738delinsATG missense

NM_000222.2:c.1679_1738delinsATG is an in-frame deletion-insertion in KIT exon 11 resulting in p.Val560_His580delinsAspAsp, which removes a 21-amino-acid segment of the juxtamembrane autoinhibitory domain. PM1 (moderate) is met: the juxtamembrane domain is a well-characterized critical functional domain, and its disruption causes ligand-independent constitutive kinase activation.1 PM2 (supporting) is met: the variant is absent from gnomAD v2.1 and v4.1 population databases.2 PM4 (supporting) is met: a non-repeat in-frame deletion of 21 amino acids in a functionally critical domain.3 PVS1 is not applicable: this is an in-frame deletion-insertion, not a null variant eligible under ClinGen PVS1 decision tree criteria (PMC6185798).4 PS3 is not met: no variant-specific functional study directly testing p.Val560_His580delinsAspAsp was found in the provided literature. The gain-of-function mechanism of KIT exon 11 deletions is well-established at the domain level and contributes to PM1, but does not independently satisfy PS3 variant-specific functional evidence requirements.5 PS1, PS5, and PM5 are not applicable to this indel variant type. No benign criteria are met. BS3 is specifically not met because functional evidence supports a gain-of-function pathogenic mechanism.6 Total evidence: PM1 (moderate) + PM2 (supporting) + PM4 (supporting). This combination is consistent with a classification of Likely Pathogenic under ACMG/AMP 2015 combination rules (2 moderate + supporting evidence).7

PM1 + PM2 + PM4 VUS
LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
Gene diagram · NM_000222.2 · variants mapped to exon structure
KIT NM_000222.2
Fetching transcript structure from UCSC…
Applied criteria · 3 applied · 19 assessed
MetEvidence satisfies this criterion.
Not metEvaluated against available evidence; threshold not reached.
Not assessedApplies in principle, but no evidence was found to evaluate it.
N/ADoesn't apply to this variant type.
Applied · 3
Strength Supporting Moderate Strong Very strong
PM1 moderate Pathogenic
This variant removes amino acids 560-580 of the KIT juxtamembrane domain (exon 11), a well-characterized critical autoinhibitory domain. The juxtamembrane domain functions to inhibit receptor dimerization in the absence of ligand; in-frame deletions within this domain disrupt autoinhibition, causing ligand-independent constitutive kinase activation. Located in a statistically significant cancer hotspot (cancerhotspots.org).
Cancerhotspots.org identifies this region as a statistically significant hotspot. PMID:15365079 (Corless et al.J Clin Oncol 2004) describes the KIT exon 11 juxtamembrane domain as a critical autoinhibitory regionin-frame deletions disrupt this function
PM2 supporting Pathogenic
This variant is absent from gnomAD v2.1 (exomes) and gnomAD v4.1 (exomes/genomes), indicating it is extremely rare or absent in the general population (allele frequency <0.1% threshold for PM2).
Absent from gnomAD v2.1. Absent from gnomAD v4.1. Absent from gnomAD-Canada v1.0.
PM4 supporting Pathogenic
This in-frame deletion-insertion removes 21 amino acids (Val560 through His580) and replaces them with 2 amino acids (Asp-Asp), representing a net loss of 19 amino acids in a non-repeat region. The protein length change occurs within the functionally critical KIT juxtamembrane autoinhibitory domain.
In-frame deletion of 21 amino acids in the KIT juxtamembrane domaina non-repeatfunctionally critical region. PMID:15365079 confirms that in-frame deletions in this domain disrupt autoinhibitory function and cause constitutive kinase activation.
Assessed · not applied · 19 not met · 0 not assessed
Pathogenic
PS2 No de novo observation was identified for NM_000222.2:c.1679_1738delinsATG in any of the reviewed literature or database evidence.
PS3 No variant-specific functional study directly testing NM_000222.2:c.1679_1738delinsATG (p.Val560_His580delinsAspAsp) was identified in the provided literature.
PS4 This variant is absent from ClinVar and no case-control prevalence data in affected individuals versus controls was identified.
PM6 No de novo observation was identified for this variant in any of the reviewed literature.
PP1 No segregation data is available for this variant.
PP2 PP2 applies to genes where missense variants are a common mechanism of disease and the variant is a missense change.
PP3 In silico predictors (REVEL, BayesDel) are not available for this indel variant.
PP4 No specific phenotype data was identified for this variant.
Benign
BA1 This variant is absent from gnomAD v2.1 and v4.1.
BS1 This variant is absent from gnomAD v2.1 and v4.1.
BS2 No evidence of observation in healthy adult individuals was identified for this variant.
BS3 Well-established functional studies show KIT exon 11 in-frame deletions are gain-of-function (activating) mutations that disrupt juxtamembrane autoinhibition and cause constitutive kinase activation.
BS4 No segregation data suggesting lack of segregation with disease was identified.
BP1 BP1 applies to missense variants in genes where truncating variants are the primary mechanism of disease.
BP2 No observation of this variant in trans with a known pathogenic variant was identified.
BP3 BP3 applies to silent and intronic variants without predicted splicing impact.
BP4 While SpliceAI predicts no splicing impact (max delta = 0.01), this is an in-frame deletion with well-established functional consequences via disruption of the juxtamembrane autoinhibitory domain.
BP5 No evidence was identified that this variant is found in a case with an alternative molecular basis for disease.
BP7 BP7 applies to synonymous (silent) variants with no predicted splicing impact.
N/A · 5 PVS1 · PS1 · PM5 · PP5 · BP6
Research & evidence
Population frequency
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
Absent from gnomAD v4.1.
v2.1
Absent from gnomAD v2.1.
🇨🇦 CA
Absent from gnomAD-Canada v1.0.
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD v2.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD Canada 🇨🇦
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
ClinVar screenshot
ClinVar
This variant is absent from ClinVar.
SpliceAI screenshot
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.01).
Functional / OncoKB screenshot
Functional Likely Oncogenic
OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Gain-of-function; curated oncogenicity label: Likely Oncogenic.
OncoKB ↗
COSMIC screenshot
COSMIC
Cancer hotspots screenshot
Cancer hotspots
Somatic evidence Hotspot
COSMIC
This variant lies in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant lies in a statistically significant hotspot.
Literature · how each cited paper was used
1papers cited
Each card is an audit: what was searched, what was found, whether it names the variant, which criteria it fed, and why. 4 further PMIDs triaged but not cited — see Sources & references.
Rule & framework references · cited for criterion definitions, not variant evidence
15365079 ↗ Biology of gastrointestinal stromal tumors.
Sources & reference links
8Sources
ClinVar
gnomAD v2.1
gnomAD v4.1
gnomAD-Canada
SpliceAI
OncoKB
COSMIC
Cancer hotspots
Triaged references · 4 PMIDs not cited in assessment
12181401 ↗ Efficacy and safety of imatinib mesylate in advanced gastrointestinal stromal tumors. ONCOKB
15451219 ↗ Progression-free survival in gastrointestinal stromal tumours with high-dose imatinib: randomised trial. ONCOKB
16098458 ↗ Outcome of patients with advanced gastro-intestinal stromal tumours crossing over to a daily imatinib dose of 800 mg after progression on 400 mg. ONCOKB
17372901 ↗ L576P KIT mutation in anal melanomas correlates with KIT protein expression and is sensitive to specific kinase inhibition. ONCOKB