Back
NM_000314.8:c.101_126del
p.Ala34GlyfsTer9 · PTEN
0%
complete
Final classification
Likely Pathogenic
PVS1PM2
PTEN
c.101_126del
p.Ala34GlyfsTer9
This variant

The PTEN c.101_126del (p.Ala34GlyfsTer9; p.A34Gfs*9) variant has not been observed in somatic cancers in COSMIC and has not been reported in ClinVar.

Transcript
NM_000314.8
HGVS · transcript:coding
NM_000314.8:c.101_126del
GRCh38
chr10:87894045 GCTATGGGATTTCCTGCAGAAAGACTT>G
GRCh37
chr10:89653802 GCTATGGGATTTCCTGCAGAAAGACTT>G
Richards et.al., 2015 - Combining rules v3.2.0 criteria-combination framework: matched Rule20 (1 Pathogenic.Very Strong + 1 Pathogenic.Supporting) with applied criteria: PVS1 very strong, PM2 supporting; maps to Likely Pathogenic.
Classification rationale
PVS1PM2 Likely Pathogenic
PTEN c.101_126del

The PTEN c.101_126del (p.Ala34GlyfsTer9; p.A34Gfs*9) variant has not been observed in somatic cancers in COSMIC and has not been reported in ClinVar.1 This variant is absent from gnomAD v2.1 and gnomAD v4.1, placing it below the PTEN Expert Panel PM2 threshold of <0.00001 (0.001%) and supporting PM2 at the supporting level.2 No direct functional study of this exact deletion was identified, and the PTEN phosphatase activity assay resource curated by the Expert Panel applies to missense variants rather than this frameshift variant.3 This deletion causes an early frameshift predicted to produce p.(Ala34GlyfsTer9) [p.(A34Gfs*9)]; under the PTEN PVS1 decision tree, a truncating variant 5' to p.D375 in NM_000314.8 supports PVS1, and SpliceAI also predicts possible splice impact with a maximum delta score of 0.51.4

PVS1 + PM2 Likely Pathogenic
3 vcep_mmc2cspec ↗
4 vcep_pvs1_decisiontree_ptenpvs1_gene_contextpvs1_variant_assessmentspliceai ↗
LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
Gene diagram · NM_000314.8 · variants mapped to exon structure
PTEN NM_000314.8
Fetching transcript structure from UCSC…
Applied criteria · 2 applied · 15 assessed
MetEvidence satisfies this criterion.
Not metEvaluated against available evidence; threshold not reached.
Not assessedApplies in principle, but no evidence was found to evaluate it.
N/ADoesn't apply to this variant type.
Applied · 2
Strength Supporting Moderate Strong Very strong
PVS1 very strong Pathogenic
This variant is an early frameshift deletion in PTEN, NM_000314.8:c.101_126del, predicted to cause p.(Ala34GlyfsTer9) [p.(A34Gfs*9)]. Under the PTEN-specific PVS1 decision tree, a frameshift at or 5' to p.D375 in the biologically relevant transcript NM_000314.8 is assigned PVS1, and this predicted truncation is far upstream of that threshold and expected to undergo nonsense-mediated decay.
Frameshift consequence p.(Ala34GlyfsTer9) / p.(A34Gfs*9)PTEN loss of function is an established disease mechanism in the PTEN VCEP frameworkPTEN PVS1 decision tree assigns PVS1 to frameshift variants at or 5' to p.D375 in NM_000314.8
PM2 supporting Pathogenic
This variant is absent from gnomAD v2.1 and gnomAD v4.1. This population frequency is below the PTEN Expert Panel PM2 threshold of <0.00001 (0.001%), supporting PM2 at the supporting level.
Absent from gnomAD v2.1Absent from gnomAD v4.1PTEN PM2 threshold is <0.00001
Assessed · not applied · 4 not met · 11 not assessed
Pathogenic
PS2 No confirmed de novo observation was identified for this variant.
PS3 No direct functional study of this exact deletion was identified that would support a damaging effect at the PS3 evidence level.
PS4 No case series, enrichment study, or count of unrelated affected individuals carrying this variant was identified.
PM1 This variant does not meet PM1 because it affects codon 34, which is outside the PTEN catalytic motif residues defined by the PTEN Expert Panel (90-94, 123-130, and 166-168).
PM6 No presumed de novo observation was identified for this variant.
PP1 No segregation data were identified for this variant.
PP3 SpliceAI predicts possible splice impact with a maximum delta score of 0.51, which is above a benign range, but the PTEN Expert Panel requires concordant splicing predictors for splicing-based PP3/BP4 use.
Benign
BA1 This variant does not meet BA1 because it is absent from gnomAD v2.1 and gnomAD v4.1, which is below the PTEN BA1 threshold of >0.00056 (0.056%).
BS1 This variant does not meet BS1 because it is absent from gnomAD v2.1 and gnomAD v4.1, which is below the PTEN BS1 supporting range of 0.0000043-0.000043 and strong range of 0.000043-0.00056.
BS2 No evidence was identified that this variant has been observed in the homozygous state in a healthy or PTEN hamartoma tumor syndrome-unaffected individual.
BS3 No direct functional study of this exact deletion was identified showing no damaging effect.
BS4 No lack-of-segregation evidence was identified for this variant.
BP2 No phase data were identified showing this variant in trans with a pathogenic PTEN variant or repeated cis/phase-unknown observations with different pathogenic PTEN variants.
BP4 This variant does not meet BP4.
BP5 No evidence was identified that this variant was found in an individual with an alternate highly penetrant molecular explanation for the phenotype and no overlap with PTEN-related disease.
N/A · 11 PS1 · PM3 · PM4 · PM5 · PP2 · PP4 · PP5 · BP1 · BP3 · BP6 · BP7
Research & evidence
Population frequency · supports pathogenic
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
Absent from gnomAD v4.1.
v2.1
Absent from gnomAD v2.1.
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD v2.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
ClinVar screenshot
ClinVar
This variant is absent from ClinVar.
SpliceAI screenshot
In silico
SpliceAI predicts possible splice impact for this variant (max delta score = 0.51).
Functional / OncoKB screenshot
Functional Likely Oncogenic
OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Loss-of-function; curated oncogenicity label: Likely Oncogenic.
OncoKB ↗
COSMIC screenshot
COSMIC
Cancer hotspots screenshot
Cancer hotspots
Somatic evidence Not in COSMIC / hotspots
COSMIC
This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant does not lie in a statistically significant hotspot.
Sources & reference links
8Sources
CSpec VCEP
ClinVar
gnomAD v2.1
gnomAD v4.1
SpliceAI
OncoKB
COSMIC
Cancer hotspots