Back
NM_001202544.1:c.1657_1716+4dup
p.? · CUX1
ACMG/AMP
0%
complete
Final classification
VUS
PM2
CUX1
c.1657_1716+4dup
p.?
This variant

The CUX1 c.1657_1716+4dup (NP_001189473.1:p.?) variant has not been reported in ClinVar.

Transcript
NM_001202544.1
HGVS · transcript:coding
NM_001202544.1:c.1657_1716+4dup
GRCh38
chr7:102280060 G>GCTGCGGTACTCGTCCCAGTACGAGGAGCGCCTGGACCCCTTCTCCTCCTTCAGCAAGCGGGTTC
GRCh37
chr7:101923352 G>GCTGCGGTACTCGTCCCAGTACGAGGAGCGCCTGGACCCCTTCTCCTCCTTCAGCAAGCGGGTTC
gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PM2 supporting; combination = 1 supporting, which maps to VUS.
Classification rationale
PM2 VUS
CUX1 c.1657_1716+4dup

The CUX1 c.1657_1716+4dup (NP_001189473.1:p.?) variant has not been reported in ClinVar.1 This variant is absent from gnomAD v2.1 and gnomAD v4.1, which supports rarity in population databases.2 Germline loss of function is an established disease mechanism for CUX1, but this duplication does not fall into the generic PVS1 default null-variant categories based on the available variant-level assessment.3 SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.05.4

PM2 VUS
3 pvs1_gene_contextpvs1_variant_assessment
LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
Gene diagram · NM_001202544.1 · variants mapped to exon structure
CUX1 NM_001202544.1
Fetching transcript structure from UCSC…
Applied criteria · 1 applied · 24 assessed
MetEvidence satisfies this criterion.
Not metEvaluated against available evidence; threshold not reached.
Not assessedApplies in principle, but no evidence was found to evaluate it.
N/ADoesn't apply to this variant type.
Applied · 1
Strength Supporting Moderate Strong Very strong
PM2 supporting review Pathogenic
This variant is absent from gnomAD v2.1 and gnomAD v4.1, which is below the generic rarity threshold of 0.1% for PM2 support and is consistent with a rare variant.
Absent from gnomAD v2.1.Absent from gnomAD v4.1.
Assessed · not applied · 4 not met · 20 not assessed
Pathogenic
PVS1 Germline loss of function is an established disease mechanism for CUX1, but this duplication does not fall into the generic PVS1 default null-variant categories of nonsense, frameshift, or canonical +/-1,2 splice variants, so PVS1 is not applied.
PS1 No evidence was identified showing that this variant results in the same amino acid change as a previously established pathogenic variant.
PS2 No confirmed de novo occurrence data were identified for this variant.
PS3 No well-established functional studies were identified for this variant.
PS4 No evidence was identified showing that this variant is enriched in affected individuals compared with controls.
PM1 Available evidence does not establish that this variant lies in a mutational hotspot or a well-studied critical region without benign variation.
PM3 No data were identified showing this variant in trans with another pathogenic variant.
PM4 This duplication extends from coding sequence into intronic sequence, and the resulting protein consequence remains uncertain, so protein-length change evidence cannot be applied from the available data.
PM5 No evidence was identified for a different pathogenic missense change at the same residue because the protein consequence of this variant is unresolved.
PM6 No presumed de novo occurrence data were identified for this variant.
PP1 No segregation data were identified for this variant.
PP3 Available computational evidence does not support a damaging splicing effect because SpliceAI shows a maximum delta score of 0.05, which is below commonly used splice-impact thresholds; REVEL and BayesDel were not available because this is not an SNV.
PP4 No phenotype information was provided to determine whether the observed clinical features are highly specific for a CUX1-related disorder.
PP5 No reputable source classification was identified for this variant.
Benign
BA1 This variant is absent from gnomAD v2.1 and v4.1 and therefore does not meet the stand-alone benign frequency threshold of 1%.
BS1 This variant is absent from gnomAD v2.1 and v4.1 and therefore does not exceed the benign frequency threshold of 0.3%.
BS2 No evidence was identified showing this variant in healthy adults for a disorder with expected penetrance at the relevant age.
BS3 No well-established functional studies were identified showing no damaging effect for this variant.
BS4 No non-segregation data were identified for this variant.
BP2 No phasing data were identified to determine whether this variant occurs in trans with a pathogenic variant for a dominant disorder or in cis with another pathogenic variant.
BP3 Available evidence does not show that this duplication is an in-frame event in a repetitive region without known function.
BP4 SpliceAI predicts no significant splice impact with a maximum delta score of 0.05, but this exon-intron duplication also alters coding sequence and the overall transcript and protein consequence remains uncertain, so benign computational evidence is not applied.
BP5 No alternate molecular explanation for disease was provided, so this criterion cannot be assessed from the available evidence.
BP6 No reputable source reported this variant as benign or likely benign.
N/A · 3 PP2 · BP1 · BP7
Research & evidence
Population frequency
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
Absent from gnomAD v4.1.
v2.1
Absent from gnomAD v2.1.
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD v2.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
ClinVar screenshot
ClinVar
This variant is absent from ClinVar.
SpliceAI screenshot
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.05).
Functional No data
No calibrated functional assay or RNA evidence was identified for this variant.
OncoKB ↗
COSMIC screenshot
COSMIC
Somatic evidence
COSMIC
This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant does not lie in a statistically significant cancer hotspot.
COSMIC ↗
Sources & reference links
6Sources
ClinVar
gnomAD v2.1
gnomAD v4.1
SpliceAI
OncoKB
COSMIC