Back
NM_003579.4:c.1093_1169+15dup
p.? · RAD54L
ACMG/AMP
0%
complete
Final classification
VUS
PP3BS1
RAD54L
c.1093_1169+15dup
p.?
inframe insertion

RAD54L encodes a chromatin-remodeling protein in the SNF2 family of helicases that helps repair double-stranded DNA breaks through homologous recombination, working with the central repair protein RAD51 to promote DNA pairing, strand exchange, and stabilization of the recombination machinery. It also helps disassemble RAD51 from DNA once recombination has been completed. Alterations in RAD54L have been reported in breast cancers, colon cancers, and lymphomas, though somatic changes in the gene are infrequent in human cancers and it has not been established as a cancer driver.

This variant

RAD54L helps repair double-strand DNA breaks through homologous recombination, and germline alterations in it are only putative cancer-predisposition candidates. This duplication is classified VUS: its high frequency in East and South Asian populations (up to 0.88%) argues against a strongly penetrant disease allele, yet its location at the exon 10 splice donor with a strong predicted splice gain (SpliceAI 0.96) leaves a possible splicing effect unresolved without RNA or functional studies.

Transcript
NM_003579.4
HGVS · transcript:coding
NM_003579.4:c.1093_1169+15dup
GRCh38
chr1:46270708 T>TCGAGACGCTGCTGCTAGTGAGGCAGACAGGCAGCTAGGAGAGGAGCGGCTGCGGGAGCTCACCAGCATTGTGAATAGGTAATGACCTTAAGC
GRCh37
chr1:46736380 T>TCGAGACGCTGCTGCTAGTGAGGCAGACAGGCAGCTAGGAGAGGAGCGGCTGCGGGAGCTCACCAGCATTGTGAATAGGTAATGACCTTAAGC
VUS: the only met criteria conflict — PP3 supporting (SpliceAI max delta 0.96) versus BS1 strong (population AF 0.33–0.88% vs the 0.3% threshold) — matching no ACMG/AMP combination rule.
Classification rationale
PP3 BS1 VUS
RAD54L c.1093_1169+15dup inframe insertion

PP3 (Supporting): SpliceAI predicts a novel donor splice site with max delta 0.96, above the >=0.8 'very likely' splice-altering threshold. BS1 (Strong): allele frequency exceeds the 0.3% threshold in East Asian (0.734%) and South Asian (0.471%) populations, with 6 homozygotes in gnomAD v4.1. The combination of 1 supporting pathogenic criterion (PP3) with 1 strong benign criterion (BS1) is conflicting evidence that matches no benign, likely benign, likely pathogenic, or pathogenic threshold; the variant is classified as Variant of Uncertain Significance (VUS).

PP3 + BS1 → VUS
LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
Gene diagram · NM_003579.4 · variants mapped to exon structure
RAD54L NM_003579.4
Fetching transcript structure from UCSC…
Applied criteria · 2 applied · 20 assessed
MetEvidence satisfies this criterion.
Not metEvaluated against available evidence; threshold not reached.
Not assessedApplies in principle, but no evidence was found to evaluate it.
N/ADoesn't apply to this variant type.
Applied · 2
Strength Supporting Moderate Strong Very strong
PP3 supporting Pathogenic
Met (supporting): SpliceAI predicts a donor splice-site gain with max delta 0.96, above the >=0.8 'very likely' splice-altering threshold.
SpliceAI Lookup (source_registry key 'spliceai'): DS_AG=0.0, DS_AL=0.02, DS_DG=0.96, DS_DL=0.41, DP_DG=0, DP_DL=77, max_delta_score=0.96.SpliceAI threshold: score >=0.8 = 'very likely' splice-altering, >=0.5 = 'likely', >=0.2 = 'possible' (Jaganathan et al., Cell 2019;176(3):535-548, PMID 30661751). With max delta 0.96 >= 0.8, the prediction supports PP3.Generic ACMG/AMP PP3 definition: computational evidence including splicing impact supports a deleterious effect on the gene or gene product (Richards et al. 2015, Genet Med 17(5):405-424, PMID 25741868; framework file output/generic_acmg_classification_rules.md).
BS1 strong Benign
Met (strong): East Asian (0.734%) and South Asian (0.471%) allele frequencies exceed the 0.3% threshold, with 6 homozygotes in gnomAD v4.1. Confidence is moderate because RAD54L disease prevalence and penetrance are not established.
gnomad_v4: East Asian AF 0.734% (326/44,406) and South Asian AF 0.471% (422/89,650) both exceed 0.3%; grpmax FAF 0.669%; 6 homozygotes (EAS 4, SAS 1, remaining 1)gnomad_canada: South Asian AF 0.884% (12/1,358) and East Asian AF 0.754% (10/1,326) exceed 0.3%gnomad_v2: East Asian AF 0.333% (65/19,546) just exceeds 0.3%; 1 homozygote
Assessed · not applied · 9 not met · 11 not assessed
Pathogenic
PVS1 Not met: the protein consequence is unknown (NP_003570.2:p.?) and no RNA or functional data confirm the predicted frameshift or loss of function.
PS2 Not assessed: no proband or parental-testing data were available to establish a confirmed de novo occurrence.
PS3 Not assessed: no functional studies of this exact variant exist; an in silico splice prediction (SpliceAI 0.96) cannot substitute for a validated assay.
PS4 Not assessed: no case-control or affected-cohort prevalence data were available for this variant.
PM2 Not met: the highest population allele frequency (South Asian 0.884%, East Asian 0.734%) far exceeds the 0.1% rarity threshold, and homozygotes are observed.
PM3 Not assessed: no proband or family genotype data were available to determine trans phase with a pathogenic variant.
PM4 Not met: no in-frame change is established; retaining the 92-bp duplication (not a multiple of 3) would cause a frameshift, not an in-frame insertion.
PM6 Not assessed: no proband or parental-testing data were available to support an assumed de novo occurrence.
PP1 Not assessed: no affected-family segregation data were available.
PP4 Not assessed: no proband phenotype or family-history data were available.
PP5 Not met: the sole ClinVar submission is a single laboratory's 'Likely benign'; no expert-panel pathogenic classification exists.
Benign
BA1 Not met: maximum allele frequency (0.884%, South Asian) is below the 1% BA1 threshold.
BS2 Not met: RAD54L is only a putative adult-onset cancer-susceptibility candidate, so the full-penetrance early-onset requirement is not satisfied despite 6 gnomAD homozygotes.
BS3 Not assessed: no functional studies demonstrating a benign (non-damaging) effect were available.
BS4 Not assessed: no affected-family non-segregation data were available.
BP2 Not assessed: no cis/trans phase data relative to a pathogenic variant were available.
BP3 Not met: the predicted outcomes are a normal transcript or a frameshift, and exon 10 is not a functionally inert repeat region.
BP4 Not met: the only computational evidence strongly predicts splice impact (SpliceAI max delta 0.96), the opposite of a benign prediction.
BP5 Not assessed: no case data on an alternative molecular basis of disease were available.
BP6 Not met: the 'Likely benign' label comes from a single laboratory, not an expert panel, so it cannot trigger BP6.
N/A · 6 PS1 · PM1 · PM5 · PP2 · BP1 · BP7
Research & evidence
Population frequency
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
This variant is present in gnomAD v4.1 (AF= 0.000493167; MAF= 0.04932%, 795/1612030 alleles, homozygotes = 6) and has highest observed frequency in the East Asian population (AF= 0.00734135; MAF= 0.73414%, 326/44406 alleles, homozygotes = 4); grpmax FAF= 0.00668501.
v2.1
This variant is present in gnomAD v2.1 (AF= 0.000397499; MAF= 0.03975%, 112/281762 alleles, homozygotes = 1) and has highest observed frequency in the East Asian population (AF= 0.00332549; MAF= 0.33255%, 65/19546 alleles, homozygotes = 1); grpmax FAF= 0.00270253.
🇨🇦 CA
This variant is present in gnomAD-Canada v1.0 (AF= 0.0011952624144300772, 22/18406 alleles, homozygotes = 0).
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
0.049% · 795 / 1,612,030
6 hom · FAF 0.67%
East Asian
326 / 44,406
0.73%
4 hom
South Asian
422 / 89,650
0.47%
1 hom
Remaining individuals
34 / 62,310
0.055%
1 hom
African/African American
5 / 75,024
0.0067%
Admixed American
2 / 60,016
0.0033%
European (non-Finnish)
6 / 1,180,008
0.00051%
+ 4 not observed (European (Finnish), Amish, Middle Eastern, Ashkenazi Jewish)
gnomAD v2.1
0.04% · 112 / 281,762
1 hom · FAF 0.27%
East Asian
65 / 19,546
0.33%
1 hom
South Asian
46 / 29,960
0.15%
Remaining individuals
1 / 7,212
0.014%
+ 5 not observed (African/African American, Admixed American, Ashkenazi Jewish, European (Finnish), European (non-Finnish))
gnomAD Canada 🇨🇦
0.12% · 22 / 18,406
0 hom · FAF 0.51%
indel · split
South Asian
12 / 1,358
0.88%
East Asian
10 / 1,326
0.75%
+ 7 not observed (African/African American, Latino/Admixed American, Ashkenazi Jewish, European (Finnish), Middle Eastern, European (non-Finnish), Remaining individuals)
ClinVar screenshot
ClinVar
This variant has been reported in ClinVar as Likely benign (1 clinical laboratory). (ClinVarID = 4281005)
SpliceAI screenshot
In silico
SpliceAI predicts possible splice impact for this variant (max delta score = 0.96).
Functional No data
No calibrated functional assay or RNA evidence was identified for this variant.
OncoKB ↗
COSMIC screenshot
COSMIC
Somatic evidence
COSMIC
This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant does not lie in a statistically significant cancer hotspot.
COSMIC ↗
Sources & reference links
7Sources
ClinVar
gnomAD v2.1
gnomAD v4.1
gnomAD-Canada
SpliceAI
OncoKB
COSMIC