Back
NM_004119.2:c.1732_1797dup
p.Met578_Tyr599dup · FLT3
Local FLT3 ITD / activating length-mutation framework · vlocal-flt3-itd-framework-v1
0%
complete
Final classification
Likely Pathogenic
PM1PM2PM5
FLT3
c.1732_1797dup
p.Met578_Tyr599dup
This variant

The FLT3 c.1732_1797dup (p.Met578_Tyr599dup) variant has not been observed in somatic cancers in COSMIC and has not been reported in ClinVar.

Transcript
NM_004119.2
HGVS · transcript:coding
NM_004119.2:c.1732_1797dup
GRCh38
chr13:28034121 C>CATATTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCGGTCACCTGTACCAT
GRCh37
chr13:28608258 C>CATATTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCGGTCACCTGTACCAT
Applied the Local FLT3 ITD / activating length-mutation framework from final_classification_framework.json; this framework retains ACMG/AMP 2015 final category thresholds while using FLT3-specific criterion specifications.
Classification rationale
PM1PM2PM5 Likely Pathogenic
FLT3 c.1732_1797dup

The FLT3 c.1732_1797dup (p.Met578_Tyr599dup) variant has not been observed in somatic cancers in COSMIC and has not been reported in ClinVar.1 This variant is absent from gnomAD v2.1 and gnomAD v4.1, with an observed population frequency of 0, which is below the default PM2 rarity threshold of 0.1%.2 The duplicated segment spans the FLT3 juxtamembrane ITD hotspot and includes the classic codon 589-599 activating cluster, which supports hotspot-class evidence, but no exact-variant OncoKB functional assertion was identified for p.Met578_Tyr599dup.3 SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.18.4

PM1 + PM2 + PM5 Likely Pathogenic
3 vcep_f_l_t_3___i_t_d___h_o_t_s_p_o_t___a_n_d___f_u_n_c_t_i_o_nvcep_f_l_t_3___o_n_c_o_k_b___g_u_i_d_a_n_c_eoncokb ↗
LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
Gene diagram · NM_004119.2 · variants mapped to exon structure
FLT3 NM_004119.2
Fetching transcript structure from UCSC…
Applied criteria · 3 applied · 18 assessed
MetEvidence satisfies this criterion.
Not metEvaluated against available evidence; threshold not reached.
Not assessedApplies in principle, but no evidence was found to evaluate it.
N/ADoesn't apply to this variant type.
Applied · 3
Strength Supporting Moderate Strong Very strong
PM1 Moderate Pathogenic
This variant is an in-frame tandem duplication, p.Met578_Tyr599dup, in the FLT3 juxtamembrane ITD hotspot region. The duplicated segment spans codons 578-599 and includes the classic activating codon 589-599 cluster, where recurrent FLT3 ITDs have been reported; this supports PM1 at Moderate strength under the local FLT3 framework.
Mutalyzer/VariantValidator normalized the event as a duplicated reference intervalprotein consequence p.(Met578_Tyr599dup) in exon 14 juxtamembrane regionlocal FLT3 framework defines codons 589-599 as the canonical activating hotspot
PM2 Moderate Pathogenic
This variant is absent from gnomAD v2.1 and absent from gnomAD v4.1, so the observed population frequency is 0, which is below the default PM2 rarity threshold of 0.1%. This rarity supports PM2.
gnomAD v2.1: absentgnomAD v4.1: absent
PM5 Moderate Pathogenic
This variant is a novel in-frame FLT3 tandem duplication in the established juxtamembrane activating ITD hotspot class. The exact duplicated sequence has not been individually curated in ClinVar or OncoKB, but the event is an ITD-class analogue spanning the classic codon 589-599 hotspot, where pathogenic/oncogenic FLT3 ITDs and activating length mutations are already established; this meets the local FLT3-specific PM5 rule at Moderate strength.
Variant absent from ClinVarOncoKB did not identify exact-variant curationlocal FLT3 framework extends PM5 to novel ITD / activating length-mutation events in the same established hotspot class
Assessed · not applied · 5 not met · 13 not assessed
Pathogenic
PS2 No confirmed de novo data were identified, so PS2 was not assessed.
PS3 Available evidence supports FLT3 internal tandem duplications as an activating variant class in the juxtamembrane region, but no exact-variant OncoKB assertion or variant-specific functional study was identified for p.Met578_Tyr599dup.
PS4 No case-control enrichment or case-series data demonstrating increased prevalence in affected individuals were identified, so PS4 was not assessed.
PM3 No phase or recessive trans observations were identified, so PM3 was not assessed.
PM4 This variant causes an in-frame protein length change, but in the local FLT3 framework canonical juxtamembrane ITD evidence is already captured by PM1 and the FLT3-specific PM5 rule.
PM6 No assumed de novo observation without confirmed maternity and paternity was identified, so PM6 was not assessed.
PP1 No segregation data were identified, so PP1 was not assessed.
PP4 No phenotype-specific clinical data were identified to assess whether the presentation is highly specific for a FLT3-related germline disorder, so PP4 was not assessed.
PP5 No reputable external pathogenic classification was identified because this variant is absent from ClinVar, so PP5 was not assessed.
Benign
BA1 This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed population frequency is 0 and well below the BA1 threshold of 1%.
BS1 This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed population frequency is 0 and below the BS1 threshold of 0.3%.
BS2 No data were identified showing this variant in healthy adult individuals in a context sufficient for BS2, so BS2 was not assessed.
BS3 No well-established functional study demonstrating a benign effect for this exact variant was identified, so BS3 was not assessed.
BS4 No nonsegregation data were identified, so BS4 was not assessed.
BP2 No phase data with another pathogenic variant were identified, so BP2 was not assessed.
BP3 This variant is an in-frame duplication in the established FLT3 juxtamembrane activating hotspot region, not a benign repeat-region event without known function.
BP5 No alternate molecular explanation for the phenotype was identified, so BP5 was not assessed.
BP6 No reputable external benign classification was identified because this variant is absent from ClinVar, so BP6 was not assessed.
N/A · 7 PVS1 · PS1 · PP2 · PP3 · BP1 · BP4 · BP7
Research & evidence
Population frequency · supports pathogenic
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
Absent from gnomAD v4.1.
v2.1
Absent from gnomAD v2.1.
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD v2.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
ClinVar screenshot
ClinVar
This variant is absent from ClinVar.
SpliceAI screenshot
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.18).
Functional / OncoKB screenshot
Functional
OncoKB oncogenicity for this specific variant: not classified (variant has not been individually curated).
OncoKB ↗
COSMIC screenshot
COSMIC
Cancer hotspots screenshot
Cancer hotspots
Somatic evidence Not in COSMIC / hotspots
COSMIC
This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant does not lie in a statistically significant hotspot.
Literature · how each cited paper was used
4papers cited
Each card is an audit: what was searched, what was found, whether it names the variant, which criteria it fed, and why.
PMID 11090077
Found
Structured finding pending for this record — see source link.
Applied to
PM1 Moderate
PM5 Moderate
PMID 11756186
Found
Structured finding pending for this record — see source link.
Applied to
PM1 Moderate
PM5 Moderate
PMID 12384447
Found
Structured finding pending for this record — see source link.
Applied to
PM5 Moderate
PMID 9737679
Found
Structured finding pending for this record — see source link.
Applied to
PM1 Moderate
PM5 Moderate
Sources & reference links
7Sources
ClinVar
gnomAD v2.1
gnomAD v4.1
SpliceAI
OncoKB
COSMIC
Cancer hotspots