Back
NM_004119.2:c.1792_1793insCTACGTTGATTTCAGAGAATATGA
p.Glu598delinsAlaThrLeuIleSerGluAsnMetLys · FLT3
ACMG/AMP
0%
complete
Final classification
VUS
PM1PM2
FLT3
c.1792_1793insCTACGTTGATTTCAGAGAATATGA
p.Glu598delinsAlaThrLeuIleSerGluAsnMetLys
This variant

The FLT3 c.1792_1793insCTACGTTGATTTCAGAGAATATGA (p.(Glu598delinsAlaThrLeuIleSerGluAsnMetLys)) variant has not been observed in somatic cancers in COSMIC and has not been reported in ClinVar; however, OncoKB classifies this specific variant as Likely Oncogenic with a likely gain-of-function effect.

Transcript
NM_004119.2
HGVS · transcript:coding
NM_004119.2:c.1792_1793insCTACGTTGATTTCAGAGAATATGA
GRCh38
chr13:28034126 T>TTCATATTCTCTGAAATCAACGTAG
GRCh37
chr13:28608263 T>TTCATATTCTCTGAAATCAACGTAG
Generic ACMG/AMP 2015 final classification combination rules were used because no usable official VCEP/CSPEC or local custom gene-specific final-classification framework was available.
Classification rationale
PM1PM2 VUS
FLT3 c.1792_1793insCTACGTTGATTTCAGAGAATATGA

The FLT3 c.1792_1793insCTACGTTGATTTCAGAGAATATGA (p.(Glu598delinsAlaThrLeuIleSerGluAsnMetLys)) variant has not been observed in somatic cancers in COSMIC and has not been reported in ClinVar; however, OncoKB classifies this specific variant as Likely Oncogenic with a likely gain-of-function effect.1 This variant is absent from gnomAD v2.1 and gnomAD v4.1, with an observed population frequency of 0, which is below the 0.1% PM2 threshold.2 Published studies show that FLT3 internal tandem duplication and related length mutations in the juxtamembrane region are activating, and codons 589-599 form a recurrent cluster; this supports the pathogenic relevance of the E598 region, although a direct functional assay for this exact variant was not identified.3 SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.08.4

PM1 + PM2 VUS
LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
Gene diagram · NM_004119.2 · variants mapped to exon structure
FLT3 NM_004119.2
Fetching transcript structure from UCSC…
Applied criteria · 2 applied · 20 assessed
MetEvidence satisfies this criterion.
Not metEvaluated against available evidence; threshold not reached.
Not assessedApplies in principle, but no evidence was found to evaluate it.
N/ADoesn't apply to this variant type.
Applied · 2
Strength Supporting Moderate Strong Very strong
PM1 moderate review Pathogenic
This variant affects FLT3 residue E598 in the juxtamembrane domain, within the codon 589-599 cluster where 47 of 51 reported FLT3 internal tandem duplications were located; published studies show this region is a recurrent activating hotspot and this supports PM1.
Variant normalization gives p.(Glu598delinsAlaThrLeuIleSerGluAsnMetLys), placing the event at E598 in exon 14.PMID:9737679 reported FLT3 ITDs clustered at codons 589-599 in the juxtamembrane domain and showed activating behavior.OncoKB classified this variant as Likely Oncogenic with likely gain-of-function effect.
PM2 moderate review Pathogenic
This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed population frequency is 0 and is below the default PM2 threshold of 0.1%.
Absent from gnomAD v2.1.Absent from gnomAD v4.1.
Assessed · not applied · 7 not met · 13 not assessed
Pathogenic
PS2 No confirmed de novo data with verified maternity and paternity were identified, so PS2 cannot be assessed.
PS3 Published functional studies support gain-of-function for FLT3 internal tandem duplication and length mutations as a class, but no well-established functional study directly testing this specific p.(Glu598delinsAlaThrLeuIleSerGluAsnMetLys) variant was identified, so PS3 is not met.
PS4 No case-control or statistically enriched germline case series data were identified for this variant, so PS4 cannot be assessed.
PM3 No recessive inheritance data or trans observations with another pathogenic variant were identified, so PM3 cannot be assessed.
PM4 This is an in-frame protein length change, but the available evidence supports a recurrent activating juxtamembrane duplication mechanism rather than a clearly independent non-repeat PM4 mechanism, so PM4 was not separately applied.
PM6 No assumed de novo occurrence without full parental confirmation was identified, so PM6 cannot be assessed.
PP1 No segregation data were identified for this variant, so PP1 cannot be assessed.
PP3 SpliceAI predicts no significant splice effect with a maximum delta score of 0.08, but no validated protein-level in silico framework was identified for this in-frame insertion/duplication, so PP3 was not applied.
PP4 No patient phenotype or family history data were provided to establish a highly specific FLT3-associated germline presentation, so PP4 cannot be assessed.
PP5 No pathogenic classification from a germline clinical laboratory source was identified; this variant is absent from ClinVar, so PP5 is not met.
Benign
BA1 This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed population frequency is 0 and is below the benign BA1 threshold of 1%.
BS1 This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed population frequency is 0 and is below the benign BS1 threshold of 0.3%.
BS2 No evidence was identified showing this variant in healthy adult individuals in a context where full penetrance would be expected, so BS2 cannot be assessed.
BS3 Available functional studies describe activating effects for FLT3 internal tandem duplication and length mutations rather than normal function for this specific variant, so BS3 is not met.
BS4 No non-segregation data were identified for this variant, so BS4 cannot be assessed.
BP2 No phase data with another pathogenic variant were identified, so BP2 cannot be assessed.
BP3 Although this is an in-frame insertion/duplication, it lies in the FLT3 juxtamembrane region that has published evidence for recurrent activating mutations, so the benign BP3 criterion for repetitive regions without known function is not met.
BP4 SpliceAI predicts no significant splice effect with a maximum delta score of 0.08, but no established benign in silico framework was identified for interpreting this in-frame insertion/duplication at the protein level, so BP4 was not applied.
BP5 No alternate molecular diagnosis explaining the phenotype was identified, so BP5 cannot be assessed.
BP6 No reputable germline source classified this variant as benign or likely benign, and the variant is absent from ClinVar, so BP6 is not met.
N/A · 6 PVS1 · PS1 · PM5 · PP2 · BP1 · BP7
Research & evidence
Population frequency
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
Absent from gnomAD v4.1.
v2.1
Absent from gnomAD v2.1.
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD v2.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
ClinVar screenshot
ClinVar
This variant is absent from ClinVar.
SpliceAI screenshot
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.08).
Functional / OncoKB screenshot
Functional Likely Oncogenic
OncoKB classifies this variant as Likely Oncogenic; biological effect: Likely Gain-of-function.
OncoKB ↗
COSMIC screenshot
COSMIC
Cancer hotspots screenshot
Cancer hotspots
Somatic evidence Not in COSMIC / hotspots
COSMIC
This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant does not lie in a statistically significant hotspot.
Literature · how each cited paper was used
4papers cited
Each card is an audit: what was searched, what was found, whether it names the variant, which criteria it fed, and why.
Flt3 mutations from patients with acute myeloid leukemia induce transformation o
Found
Structured finding pending for this record — see source link.
Applied to
PM1 moderate
FLT3 internal tandem duplication mutations associated with human acute myeloid l
Found
Structured finding pending for this record — see source link.
Applied to
PM1 moderate
A new and recurrent activating length mutation in exon 20 of the FLT3 gene in ac
Found
Structured finding pending for this record — see source link.
Applied to
PM1 moderate
Internal tandem duplication of the FLT3 gene is a novel modality of elongation m
Found
reported FLT3 ITDs clustered at codons 589-599 in the juxtamembrane domain and showed activating behavior.
Applied to
PM1 moderate
Sources & reference links
7Sources
ClinVar
gnomAD v2.1
gnomAD v4.1
SpliceAI
OncoKB
COSMIC
Cancer hotspots