Analysis in progress
Initialising…
0%
complete
This report is still being assembled — sections appear as each stage finishes. It isn't final yet.
ARID1A
Final classification
Pathogenic
ARID1A c.2378_2396del · p.Met793ArgfsTer34
ARID1A

NM_006015.5:c.2378_2396del (p.Met793ArgfsTer34) is a frameshift deletion predicted to undergo nonsense-mediated decay in ARID1A, a gene with an established loss-of-function disease mechanism associated with BAFopathies including Coffin-Siris syndrome. PVS1 is applied at very strong strength under the ClinGen SVI PVS1 framework (PMC6185798).

Gene
ARID1A
Transcript
NM_006015.5
HGVS · transcript:coding
NM_006015.5:c.2378_2396del
Consequence
N/A
GRCh38
chr1:26762274 TCCATGGGGAGCTATGGTCC>T
GRCh37
chr1:27088765 TCCATGGGGAGCTATGGTCC>T
Basis gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PVS1 very strong, PM1 moderate, PM2 supporting; combination = 1 very strong + 1 moderate + 1 supporting, which maps to Pathogenic.
gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PVS1 very strong, PM1 moderate, PM2 supporting; combination = 1 very strong + 1 moderate + 1 supporting, which maps to Pathogenic.
Classification rationale
PVS1PM1PM2 Pathogenic
ARID1A c.2378_2396del

NM_006015.5:c.2378_2396del (p.Met793ArgfsTer34) is a frameshift deletion predicted to undergo nonsense-mediated decay in ARID1A, a gene with an established loss-of-function disease mechanism associated with BAFopathies including Coffin-Siris syndrome. PVS1 is applied at very strong strength under the ClinGen SVI PVS1 framework (PMC6185798).1 The variant truncates the ARID1A protein at codon 793, removing approximately 65% of the coding sequence including all C-terminal functional domains critical for SWI/SNF chromatin remodeling complex assembly and tumor suppression. PM1 is applied at moderate strength.2 The variant is absent from all population databases including gnomAD v2.1, v4.1, and gnomAD-Canada. PM2 is applied at supporting strength.3 No variant-specific functional studies, clinical case reports, segregation data, de novo observations, or ClinVar classifications are available for this variant. All reviewed publications discuss ARID1A at the gene level and do not mention NM_006015.5:c.2378_2396del.4 Applying the ACMG/AMP 2015 combination rules: PVS1 (very strong) + PM1 (moderate) + PM2 (supporting) meets the pathogenic threshold (1 Very Strong + 1 Moderate + ≥1 Supporting). The variant is classified as Pathogenic.5

PVS1 + PM1 + PM2 Pathogenic
Gene diagram · NM_006015.5 · variants mapped to exon structure
ARID1A NM_006015.5
Fetching transcript structure from UCSC…
Applied criteria · 3 applied · 17 assessed
Applied · 3
Strength Supporting Moderate Strong Very strong
PVS1 very strong Pathogenic
NM_006015.5:c.2378_2396del is a frameshift deletion predicted to result in a premature termination codon (p.Met793ArgfsTer34) in exon 7 of 20. The variant is predicted to undergo nonsense-mediated decay. ARID1A has an established loss-of-function disease mechanism supported by germline disease context literature (BAFopathies including Coffin-Siris syndrome, fetal hydrocephalus), and the gene is eligible for generic PVS1 assessment under PMC6185798. A newer transcript version NM_006015.6 exists but does not alter the null-effect assessment.
Frameshift deletion c.2378_2396del in exon 7/20predicted NMDARID1A LoF mechanism supported by germline disease literature (BAFopathies
PM1 moderate Pathogenic
NM_006015.5:c.2378_2396del introduces a frameshift at codon 793 (p.Met793ArgfsTer34) that truncates the ARID1A protein, removing approximately 65% of the coding sequence including all C-terminal functional domains. ARID1A is a well-characterized tumor suppressor and core component of the SWI/SNF chromatin remodeling complex (PMID:21900401, PMID:22009941). The truncation removes regions essential for SWI/SNF complex assembly and chromatin remodeling activity. The variant is absent from population databases, satisfying the requirement of no benign variation in the region.
Frameshift at codon 793 truncates ARID1Aremoving C-terminal SWI/SNF functional domainsARID1A established as tumor suppressor with critical chromatin remodeling function (PMID:21900401)
PM2 supporting Pathogenic
NM_006015.5:c.2378_2396del is absent from gnomAD v2.1 (exomes), gnomAD v4.1 (exomes), and gnomAD-Canada v1.0 (genomes). Under non-VCEP generic ACMG/AMP, PM2 is applied at supporting strength for variants with allele frequency below 0.1% in population databases.
Absent from gnomAD v2.1 (0 alleles)Absent from gnomAD v4.1 (0 alleles)Absent from gnomAD-Canada v1.0 (0 alleles)
Assessed · not applied
Pathogenic
PS2 No de novo observation has been reported for NM_006015.5:c.2378_2396del.
PS3 No variant-specific functional studies have been performed for NM_006015.5:c.2378_2396del (p.Met793ArgfsTer34).
PS4 NM_006015.5:c.2378_2396del has not been reported in affected individuals.
PM6 No de novo observation has been reported for NM_006015.5:c.2378_2396del.
PP1 No segregation data are available for NM_006015.5:c.2378_2396del.
PP3 SpliceAI predicts no significant splice impact for this variant (max delta score = 0.16, well below the 0.2 threshold).
PP4 No patient phenotype or family history data are available for this variant.
PP5 NM_006015.5:c.2378_2396del is absent from ClinVar.
Benign
BA1 NM_006015.5:c.2378_2396del is absent from all population databases (gnomAD v2.1, v4.1, Canada).
BS1 NM_006015.5:c.2378_2396del is absent from all population databases.
BS2 No observation of this variant in healthy adult individuals has been reported.
BS3 No variant-specific functional studies demonstrating a benign effect have been reported for NM_006015.5:c.2378_2396del.
BS4 No segregation data are available for NM_006015.5:c.2378_2396del.
BP2 No data on co-occurrence (in trans or in cis) with a pathogenic variant are available for NM_006015.5:c.2378_2396del.
BP4 SpliceAI predicts no significant splice impact (max delta = 0.16), but multiple independent lines of computational evidence are required for BP4.
BP5 No data are available showing this variant in a case with an alternate molecular basis for disease.
BP6 NM_006015.5:c.2378_2396del is absent from ClinVar.
N/A · 8 PS1 · PM3 · PM4 · PM5 · PP2 · BP1 · BP3 · BP7
Research & evidence
Population frequency · supports pathogenic
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
Absent from gnomAD v4.1.
v2.1
Absent from gnomAD v2.1.
🇨🇦 CA
Absent from gnomAD-Canada v1.0.
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD v2.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD Canada 🇨🇦
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
ClinVar screenshot
ClinVar
This variant is absent from ClinVar.
SpliceAI screenshot
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.16).
Functional / OncoKB screenshot
Functional Likely Oncogenic
OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Loss-of-function; curated oncogenicity label: Likely Oncogenic.
OncoKB ↗
COSMIC screenshot
COSMIC
Cancer hotspots screenshot
Cancer hotspots
Somatic evidence Not in COSMIC / hotspots
COSMIC
This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant does not lie in a statistically significant hotspot.
Sources & reference links
8Sources
ClinVar
gnomAD v2.1
gnomAD v4.1
gnomAD-Canada
SpliceAI
OncoKB
COSMIC
Cancer hotspots
Triaged references · 4 PMIDs not cited in assessment
21900401 ↗ ARID1A, a factor that promotes formation of SWI/SNF-mediated chromatin remodeling, is a tumor suppressor in gynecologic cancers. ONCOKB
22009941 ↗ Somatic mutations in the chromatin remodeling gene ARID1A occur in several tumor types. ONCOKB
24899687 ↗ Roles of deletion of Arid1a, a tumor suppressor, in mouse ovarian tumorigenesis. ONCOKB
25625625 ↗ Coexistent ARID1A-PIK3CA mutations promote ovarian clear-cell tumorigenesis through pro-tumorigenic inflammatory cytokine signalling. ONCOKB