0%
MDC1c.619_642delUncertain significance
Print report
Variant interpretation report

MDC1 c.619_642del, p.(Gly207_Phe214del)

NM_014641.2:c.619_642del NP_055456.2:p.(Gly207_Phe214del) View identifiers
Classification
Uncertain significance

Variant description:

No variant summary was recorded for this case.

Five-step scale from benign to pathogenic. This variant is uncertain. Select a step to read what it means.

Uncertain.The recorded classification is uncertain significance.

In plain language

Gene-level background from the recorded interpretation.

About MDC1

No gene-level summary was recorded for this case.

LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
01The reasoning

How it was classified

The recorded framework is Not recorded. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.

Recorded applied criteria

The applied criteria and their strengths are shown as assessed under the stated framework.

Pathogenic evidence criteria: 1 Benign evidence criteria: 1
Pathogenic criteria applied · 1
PM4Supporting
PM4 · supporting

NM_014641.2:c.619_642del is a 24bp in-frame deletion removing 8 amino acids (p.Gly207_Phe214del), causing a protein length change. The deleted segment does not appear to be a simple tandem repeat region based on available sequence analysis. However, the functional significance of this specific 8-amino-acid deletion in a 2089-amino-acid protein is uncertain, warranting supporting rather than moderate strength.

Benign criteria applied · 1
BP4Supporting
BP4 · supporting

SpliceAI predicts no splice impact for this variant (max delta score = 0.00 across all splice categories). Although this is expected for an in-frame exonic deletion and represents a single computational line of evidence, it is consistent with no splicing aberration. REVEL and BayesDel are not applicable to this variant type.

Recorded classification: Uncertain significance

gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PM4 supporting, BP4 supporting benign; combination = 1 supporting + 1 supporting benign, which maps to VUS.

02The sources

Evidence at a glance

Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.

gnomAD v4.1
gnomAD v2.1
Population frequency
Not recorded

gnomAD v4.1 allele counts were not recorded for this variant.

gnomAD v2.1

Absent from gnomAD v2.1.

gnomAD-Canada

Absent from gnomAD-Canada v1.0.

No listed criterion applied
gnomAD v4.1 ↗gnomAD v2.1 ↗gnomAD-Canada ↗
SpliceAI score
0.000 maximum delta

Recorded SpliceAI maximum delta score: 0.000. Refer to the recorded PP3/BP4 rationale for interpretation.

Applied · BP4 → SpliceAI ↗
ClinVar submissions
1 reported laboratory submissions

1 Benign. ClinVar API review status: criteria provided, single submitter.

Context only ClinVar ↗
Functional evidence
Statement recorded

OncoKB did not identify variant-specific reviewed functional evidence for this variant; gene-level curated context is available for reviewer follow-up. MDC1 is a regulator of the cell cycle response to DNA damage. It has tumor suppressor functions in the context of cancer.

No listed criterion applied OncoKB ↗
COSMIC
Cancer Hotspots
Somatic evidence
3 recorded samples

This variant has previously been reported in somatic cancers (COSMIC; COSV64523420, n = 3 times).

Cancer Hotspots

This variant does not lie in a statistically significant hotspot.

Context only
COSMIC ↗Cancer Hotspots ↗
For specialists

Technical detail

ACMG/AMP criteria under Not recorded, with the data and sources behind each one.

29 criteria with recorded statuses: 2 met · 21 not met · 0 not assessed · 6 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.

Pathogenic
PVS1PS1PS2PS3PS4PM1PM2PM3PM4PM5PM6PP1PP2PP3PP4PP5PS5
Benign
BA1BS1BS2BS3BS4BP1BP2BP3BP4BP5BP6BP7
Met Not met Not assessed Not applicable

NM_014641.2:c.619_642del (p.Gly207_Phe214del) is an in-frame deletion removing 8 amino acids in MDC1.

PM4 (supporting) is met: this is a 24bp in-frame deletion causing a protein length change. The deleted segment does not appear to lie within a repetitive region.

BP4 (supporting benign) is met: SpliceAI predicts no splice impact (max delta score = 0.00).

This variant does not meet PVS1, PS1–PS5, PM1–PM3, PM5–PM6, PP1–PP5, BA1, BS1–BS4, BP1–BP3, or BP5–BP7 due to absence of supporting evidence or inapplicability to this variant type.

ClinVar classifies this variant as Benign (1 clinical laboratory, single submitter), but the review status does not meet the 3-star expert panel threshold for BP6.

This variant has been observed in somatic cancers (COSMIC, n=3), but somatic occurrence does not independently establish germline pathogenicity.

Overall classification: Uncertain Significance (VUS). One supporting pathogenic criterion (PM4) is balanced by one supporting benign criterion (BP4), yielding conflicting evidence insufficient for a likely pathogenic or likely benign classification per generic ACMG/AMP 2015 rules.

Met · 2

PM4 SupportingNM_014641.2:c.619_642del is a 24bp in-frame deletion removing 8 amino acids (p.Gly207_Phe214del), causing a protein length change. The deleted segment does not appear to be a simple tandem repeat region based on available sequence analysis. However, the functional significance of this specific 8-amino-acid deletion in a 2089-amino-acid protein is uncertain, warranting supporting rather than moderate strength. Details ▾Hide ▴
Evidence considered
  • 24bp in-frame deletion removing 8 amino acids (Gly207_Phe214del)
  • Protein length change in a non-repeat-appearing region
Still missing
  • Uncertainty about whether aa 207-214 falls within a repetitive region
  • sequence analysis suggests non-repeat but formal domain annotation lacking
BP4 SupportingSpliceAI predicts no splice impact for this variant (max delta score = 0.00 across all splice categories). Although this is expected for an in-frame exonic deletion and represents a single computational line of evidence, it is consistent with no splicing aberration. REVEL and BayesDel are not applicable to this variant type. Details ▾Hide ▴
Evidence considered
  • SpliceAI max delta = 0.00 (no predicted splice impact)
Still missing
  • No additional in silico predictors available for in-frame deletion variants
Sources
spliceai ↗

Not met · 21 · evaluated, threshold not reached

PVS1 NM_014641.2:c.619_642del is an in-frame deletion removing 8 amino acids (Gly207_Phe214del). It does not fall into the ClinGen SVI PVS1 null-variant buckets (nonsense, frameshift, or canonical ±1,2 splice consensus) per PMC6185798. The variant does not trigger nonsense-mediated decay and is not a loss-of-function null variant under the PVS1 decision tree. Details ▾Hide ▴
Evidence considered
  • In-frame deletion of 24bp removing 8 amino acids (p.Gly207_Phe214del)
  • Variant bucket: other
  • apply_generic_pvs1_framework: false
  • MDC1 gene gate: eligible (LoF mechanism supported in germline literature)
Sources
pvs1_generic_framework ↗pvs1_gene_contextpvs1_variant_assessment
PS2 No de novo observations are available for this variant. No publications or clinical reports document a de novo occurrence of NM_014641.2:c.619_642del. Details ▾Hide ▴

No further detail was recorded.

PS3 No variant-specific functional data exist for NM_014641.2:c.619_642del. OncoKB reports Unknown Oncogenic Effect with no reviewed functional evidence. No publications identified for this variant. Details ▾Hide ▴
Evidence considered
  • OncoKB: Unknown Oncogenic Effect
  • no variant-specific functional evidence
Still missing
  • No functional studies performed on this specific in-frame deletion
Sources
oncokb ↗
PS4 No case-control or statistical evidence demonstrating enrichment of this variant in affected individuals versus controls is available. Details ▾Hide ▴

No further detail was recorded.

PM1 The deleted region (aa 207-214) does not lie in a statistically significant mutational hotspot per cancerhotspots.org. No publication specifically characterizes this exact 8-amino-acid segment as a critical well-established functional domain. The broader N-terminal region of MDC1 contains SDT/TQXF motifs involved in ATM-mediated DNA damage signaling, but the specific deleted segment has not been individually characterized as a functional domain in the literature. Details ▾Hide ▴
Evidence considered
  • Not in a statistically significant hotspot (cancerhotspots.org)
  • No domain-level functional characterization for aa 207-214 in the reviewed literature
Still missing
  • No publication specifically maps a critical functional domain to MDC1 aa 207-214
PM2 The variant is absent from gnomAD v2.1, v4.1, and gnomAD-Canada. However, allele counts and allele numbers are null (not zero), indicating that this 24bp in-frame deletion cannot be reliably genotyped by short-read sequencing pipelines. The absence from gnomAD is a technological limitation rather than evidence of variant rarity, and a reliable allele frequency cannot be computed. Details ▾Hide ▴
Evidence considered
  • Absent from gnomAD v2.1 (null AC/AN)
  • Absent from gnomAD v4.1 (null AC/AN)
  • Absent from gnomAD-Canada (AC=0
  • AN=0)
Still missing
  • Population frequency not reliably ascertainable for a 24bp in-frame deletion in short-read exome data
Sources
gnomad_v2 ↗gnomad_v4 ↗gnomad_canada ↗
PM6 No de novo observations are available for this variant. No publications document a de novo occurrence of NM_014641.2:c.619_642del. Details ▾Hide ▴

No further detail was recorded.

PP1 No segregation data are available for this variant. No family studies have been published. Details ▾Hide ▴

No further detail was recorded.

PP3 No in silico prediction tools support a pathogenic effect. REVEL and BayesDel scores are not available for this variant type (in-frame deletion). SpliceAI predicts no splice impact (max delta score = 0.00), which is expected for a coding deletion and does not suggest pathogenicity. Details ▾Hide ▴
Evidence considered
  • SpliceAI max delta = 0.00 (no splice impact)
  • REVEL/BayesDel not applicable to in-frame deletions
Still missing
  • No in-frame-deletion-specific in silico predictors available for this variant
Sources
spliceai ↗
PP4 No patient phenotype or family history data are available for this case. Details ▾Hide ▴

No further detail was recorded.

PP5 ClinVar classifies this variant as Benign, not Pathogenic. PP5 requires a reputable source to report the variant as pathogenic. Details ▾Hide ▴
Evidence considered
  • ClinVar classification: Benign (ClinVar ID 2656343)
Sources
clinvar ↗
BA1 The variant is absent from gnomAD (null allele counts). There is no evidence of an allele frequency >1% in any population database. Details ▾Hide ▴
Evidence considered
  • Absent from gnomAD v2.1
  • Absent from gnomAD v4.1
Sources
gnomad_v2 ↗gnomad_v4 ↗
BS1 The variant is absent from gnomAD. There is no evidence of an allele frequency >0.3% in any population database. Details ▾Hide ▴
Evidence considered
  • Absent from gnomAD v2.1
  • Absent from gnomAD v4.1
Sources
gnomad_v2 ↗gnomad_v4 ↗
BS2 No data are available regarding observation of this variant in healthy individuals, either in the homozygous state or in trans with a pathogenic variant. Details ▾Hide ▴

No further detail was recorded.

BS3 No well-established functional studies demonstrate no deleterious effect for this variant. No functional data of any kind exist for NM_014641.2:c.619_642del. Details ▾Hide ▴
Still missing
  • No functional studies performed for this variant
BS4 No segregation data are available to demonstrate lack of cosegregation with disease in affected family members. Details ▾Hide ▴

No further detail was recorded.

BP2 No data are available regarding observation of this variant in trans with a pathogenic variant or in cis with a pathogenic variant. Details ▾Hide ▴

No further detail was recorded.

BP3 BP3 applies to in-frame deletions in repetitive regions without known function. The deleted segment (aa 207-214: Gly207_Phe214del) is in the N-terminal region of MDC1 that contains SDT/TQXF motifs involved in ATM-mediated DNA damage signaling — a functionally characterized region. There is insufficient evidence to classify this 8-amino-acid segment as a repetitive region without known function. Details ▾Hide ▴
Evidence considered
  • MDC1 N-terminal region contains known functional SDT/TQXF motifs
  • Deleted segment does not appear to be a simple repetitive region without function
Still missing
  • Formal domain annotation for aa 207-214 not available
BP5 No data are available documenting this variant in a case with an alternate molecular basis for disease. Details ▾Hide ▴

No further detail was recorded.

BP6 This variant is classified as Benign in ClinVar (ClinVar ID 2656343, 1 clinical laboratory). However, the review status is 'criteria provided, single submitter' (1-star), which does not meet the 3-star expert panel threshold required for supporting benign evidence under the adjudication framework. Details ▾Hide ▴
Evidence considered
  • ClinVar classification: Benign
  • review status: criteria provided
  • single submitter (1-star)
Still missing
  • No expert panel review of ClinVar classification
Sources
clinvar ↗
PS5 No publications or clinical reports from independent research groups document this variant in unrelated patients with the same phenotype. No PMIDs were identified across evidence sources. Details ▾Hide ▴

No further detail was recorded.

Not applicable · 6· recorded as not applicable Show reasons ▾Hide reasons ▴
PS1 N/APS1 requires a nucleotide change predicted to produce the same amino acid change as an established pathogenic variant. This is an in-frame deletion, not a nucleotide substitution producing a missense change. Details ▾Hide ▴

No further detail was recorded.

PM3 N/ASkipped per case instructions. Details ▾Hide ▴

No further detail was recorded.

PM5 N/APM5 requires a different missense change at the same residue that is pathogenic. This is an in-frame deletion, not a missense variant. The PM5 candidates harvest confirms no eligible same-residue comparator variants exist. Details ▾Hide ▴
Evidence considered
  • In-frame deletion
  • no missense comparator at same residue
Sources
pm5_candidates
PP2 N/APP2 applies to missense variants in genes with a low rate of benign missense variation. This is an in-frame deletion, not a missense variant. Details ▾Hide ▴

No further detail was recorded.

BP1 N/ABP1 applies to missense variants in genes where primarily truncating variants cause disease. This is an in-frame deletion, not a missense variant. Details ▾Hide ▴

No further detail was recorded.

BP7 N/ABP7 applies to silent (synonymous) variants with no predicted splice impact. This is an in-frame deletion removing 8 amino acids, not a silent variant. Details ▾Hide ▴

No further detail was recorded.

Identifiers

Gene
MDC1
Transcript
NM_014641.2
Coding (HGVS c.)
NM_014641.2:c.619_642del
Protein (HGVS p.)
NP_055456.2:p.(Gly207_Phe214del)
GRCh38
chr6:30713299 TGAAGGCAAAAGGCGGCCCAAGGCC>T
GRCh37
chr6:30681076 TGAAGGCAAAAGGCGGCCCAAGGCC>T
COSMIC
COSV64523420

Gene diagram

Every interpreted variant in MDC1, mapped onto the exon structure of NM_014641.2. Select a row to find it on the plot.

MDC1NM_014641.2
Fetching transcript structure from UCSC…
gnomAD v4.1 Allele count data not recorded
gnomAD v2.1 Allele count data not recorded
gnomAD-Canada v1.0 Allele count data not recorded

Statements

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

gnomAD-Canada

Absent from gnomAD-Canada v1.0.

SpliceAI and Pangolin

Pangolin splice lossmagnitude shown
-0.060
Pangolin splice gain
0.020

Other predictors

REVEL
Not available
BayesDel
Not available

How the predictions were used

BP4 SupportingSpliceAI predicts no splice impact for this variant (max delta score = 0.00 across all splice categories). Although this is expected for an in-frame exonic deletion and represents a single computational line of evidence, it is consistent with no splicing aberration. REVEL and BayesDel are not applicable to this variant type. Details ▾Hide ▴
Evidence considered
  • SpliceAI max delta = 0.00 (no predicted splice impact)
Still missing
  • No additional in silico predictors available for in-frame deletion variants
Sources
spliceai ↗
PP3 No in silico prediction tools support a pathogenic effect. REVEL and BayesDel scores are not available for this variant type (in-frame deletion). SpliceAI predicts no splice impact (max delta score = 0.00), which is expected for a coding deletion and does not suggest pathogenicity. Details ▾Hide ▴
Evidence considered
  • SpliceAI max delta = 0.00 (no splice impact)
  • REVEL/BayesDel not applicable to in-frame deletions
Still missing
  • No in-frame-deletion-specific in silico predictors available for this variant
Sources
spliceai ↗
BP7 N/ABP7 applies to silent (synonymous) variants with no predicted splice impact. This is an in-frame deletion removing 8 amino acids, not a silent variant. Details ▾Hide ▴

No further detail was recorded.

Statement

In silico

SpliceAI predicts no significant splice impact for this variant (max delta score = 0.00).

0 paper records listed. No publication is explicitly linked to an applied criterion in the recorded metadata.

Screenshots represent source records captured during evidence collection. Select one to view the recorded source content.

gnomAD v4.1 Captured gnomAD v4.1 source record Open source ↗
gnomAD v2.1 Captured gnomAD v2.1 source record Open source ↗
SpliceAI Lookup Recorded maximum delta 0.000 Open source ↗
ClinVar 1 Benign Open source ↗
COSMIC Captured COSMIC source record Open source ↗
Cancer hotspots Captured Cancer Hotspots source record Open source ↗
OncoKB Captured OncoKB source record Open source ↗

All source links

Statements for reports

The evidence statements recorded by the interpretation pipeline. They have not been reinterpreted by the page.

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

gnomAD-Canada

Absent from gnomAD-Canada v1.0.

ClinVar

This variant has been reported in ClinVar as Benign (1 clinical laboratory). (ClinVarID = 2656343)

In silico

SpliceAI predicts no significant splice impact for this variant (max delta score = 0.00).

Functional

OncoKB did not identify variant-specific reviewed functional evidence for this variant; gene-level curated context is available for reviewer follow-up. MDC1 is a regulator of the cell cycle response to DNA damage. It has tumor suppressor functions in the context of cancer.

Somatic

This variant does not lie in a statistically significant hotspot. This variant has previously been reported in somatic cancers (COSMIC; COSV64523420, n = 3 times).

Cancer Hotspots

This variant does not lie in a statistically significant hotspot.