Back
NM_021946.4:c.643_798dup
p.His215_Pro266dup · BCORL1
ACMG/AMP
0%
complete
Final classification
VUS
PM2
BCORL1
c.643_798dup
p.His215_Pro266dup
This variant

The BCORL1 c.643_798dup (p.His215_Pro266dup) variant has not been observed in somatic cancer records in COSMIC and has not been reported in ClinVar.

Transcript
NM_021946.4
HGVS · transcript:coding
NM_021946.4:c.643_798dup
GRCh38
chrX:130013408 T>TGTGCCCCACTCTGTTCCAGATGCATTCCAGGTTCCCCTCTCCGTCCCTGCCCCAGTCCCCCATTCAGGGCTTGTTCCAGTCCAAGTTGCCACTTCGGTTCCAGCTCCTTCCCCTCCCTTAGCACCTGTCCCGGCTCTGGCTCCAGCGCCACCGTCA
GRCh37
chrX:129147384 T>TGTGCCCCACTCTGTTCCAGATGCATTCCAGGTTCCCCTCTCCGTCCCTGCCCCAGTCCCCCATTCAGGGCTTGTTCCAGTCCAAGTTGCCACTTCGGTTCCAGCTCCTTCCCCTCCCTTAGCACCTGTCCCGGCTCTGGCTCCAGCGCCACCGTCA
gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PM2 supporting; combination = 1 supporting, which maps to VUS.
Classification rationale
PM2 VUS
BCORL1 c.643_798dup

The BCORL1 c.643_798dup (p.His215_Pro266dup) variant has not been observed in somatic cancer records in COSMIC and has not been reported in ClinVar.1 This variant is absent from gnomAD v2.1 and absent from gnomAD v4.1, with an observed population frequency of 0, which is below the 0.1% rarity threshold used for PM2.2 In silico splice prediction does not support an abnormal splicing effect, with a SpliceAI maximum delta score of 0.00.3

PM2 VUS
LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
Gene diagram · NM_021946.4 · variants mapped to exon structure
BCORL1 NM_021946.4
Fetching transcript structure from UCSC…
Applied criteria · 1 applied · 23 assessed
MetEvidence satisfies this criterion.
Not metEvaluated against available evidence; threshold not reached.
Not assessedApplies in principle, but no evidence was found to evaluate it.
N/ADoesn't apply to this variant type.
Applied · 1
Strength Supporting Moderate Strong Very strong
PM2 supporting review Pathogenic
This variant is absent from gnomAD v2.1 and absent from gnomAD v4.1. Its observed population frequency is therefore 0, which is below the non-VCEP PM2 threshold of 0.1%, supporting rarity.
Absent from gnomAD v2.1Absent from gnomAD v4.1
Assessed · not applied · 7 not met · 16 not assessed
Pathogenic
PVS1 BCORL1 loss of function appears to be an established germline disease mechanism, but this variant is an in-frame duplication rather than a nonsense, frameshift, or canonical splice-site variant.
PS1 PS1 is intended for the same amino acid change as a previously established pathogenic variant.
PS2 No de novo data were identified for this variant.
PS3 No well-established functional study of this specific variant was identified.
PS4 This variant has not been reported in ClinVar or COSMIC, and no case series or enrichment data in affected individuals were identified.
PM1 This variant does not lie in a statistically significant hotspot, and no critical functional domain with established pathogenic clustering at this interval was identified.
PM3 No phase data or additional pathogenic variant data were identified.
PM4 This variant is an in-frame protein duplication, but available evidence does not establish that this protein length change occurs in a clearly non-repetitive, functionally constrained region or has a demonstrated pathogenic effect.
PM6 No assumed de novo occurrence was identified for this variant.
PP1 No segregation data were identified for this variant.
PP3 SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.00.
PP4 No phenotype information was provided to assess whether the clinical presentation is highly specific for a BCORL1-related disorder.
PP5 No reputable source classification for this specific variant was identified.
Benign
BA1 This variant is absent from gnomAD v2.1 and v4.1.
BS1 This variant is absent from gnomAD v2.1 and v4.1.
BS2 No evidence was identified showing this variant in healthy adults for a disorder with expected full penetrance at an early age.
BS3 No well-established functional study showing normal function for this specific variant was identified.
BS4 No non-segregation data were identified for this variant.
BP2 No phase information or additional variant data were identified to assess BP2.
BP3 This variant is an in-frame duplication, but available evidence does not adequately establish that it lies within a benign repetitive region without known function.
BP4 SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.00, but this alone does not establish a benign protein effect for an in-frame duplication.
BP5 No alternate molecular diagnosis or alternate established cause for the phenotype was identified.
BP6 No reputable source benign classification for this specific variant was identified.
N/A · 4 PM5 · PP2 · BP1 · BP7
Research & evidence
Population frequency
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
Absent from gnomAD v4.1.
v2.1
Absent from gnomAD v2.1.
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD v2.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
ClinVar screenshot
ClinVar
This variant is absent from ClinVar.
SpliceAI screenshot
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.00).
Functional / OncoKB screenshot
Functional Unknown Oncogenic Effect
OncoKB did not identify variant-specific reviewed functional evidence for this variant; gene-level curated context is available for reviewer follow-up. BCORL1, a transcriptional repressor, is recurrently mutated in hematopoietic malignancies, astrocytomas, and intracranial germ cell tumors.
OncoKB ↗
COSMIC screenshot
COSMIC
Cancer hotspots screenshot
Cancer hotspots
Somatic evidence Not in COSMIC / hotspots
COSMIC
This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant does not lie in a statistically significant hotspot.
Sources & reference links
7Sources
ClinVar
gnomAD v2.1
gnomAD v4.1
SpliceAI
OncoKB
COSMIC
Cancer hotspots