Back
NM_181523.2:c.1350_1374del
p.His450GlnfsTer22 · PIK3R1
0%
complete
Final classification
Likely Pathogenic
PVS1PM2
PIK3R1
c.1350_1374del
p.His450GlnfsTer22
frameshift · exon 11

PIK3R1 encodes p85α, the regulatory subunit of phosphoinositide 3-kinase (PI3K), an enzyme complex that produces signaling molecules controlling cell growth, proliferation, and survival. The protein normally stabilizes and inhibits the PI3K catalytic subunit and helps the complex respond to signals from cell-surface receptors, including insulin, so alterations in this gene are associated with insulin resistance. PIK3R1 acts as a tumor suppressor: mutations that disrupt its inhibitory function can lead to abnormally active PI3K/AKT signaling and are found in several cancers, most often glioblastoma, as well as endometrial, breast, and colorectal cancers.

This variant

This Likely Pathogenic classification reflects a frameshift expected to eliminate the p85alpha regulatory subunit through nonsense-mediated decay, the loss-of-function mechanism that causes PIK3R1-related immunodeficiency and SHORT syndrome. Because p85alpha normally restrains PI3K/AKT signaling, this variant's predicted loss of function is also consistent with the gene's tumor-suppressor role in cancers such as glioblastoma, endometrial, breast, and colorectal cancer.

Transcript
NM_181523.2
HGVS · transcript:coding
NM_181523.2:c.1350_1374del
GRCh38
chr5:68293757 CATGAATATAACACTCAGTTTCAAGA>C
GRCh37
chr5:67589585 CATGAATATAACACTCAGTTTCAAGA>C
PVS1 Very Strong (+8) plus PM2 Supporting (+1) totals 9 points, meeting the PIK3R1 VCEP Rule 2 threshold (6-9 points) for Likely Pathogenic.
Classification rationale
PVS1PM2 Likely Pathogenic
PIK3R1 c.1350_1374del frameshift · exon 11

PVS1 (Very Strong): out-of-frame 25-nt deletion creates a premature stop (p.His450GlnfsTer22) predicted to trigger nonsense-mediated decay. PM2 (Supporting): variant is absent from gnomAD v4.1, below the VCEP <0.00000132 allele-frequency threshold. Combined: PVS1 (+8) + PM2 (+1) = 9 points, yielding Likely Pathogenic under PIK3R1 VCEP Rule 2 (6-9 points).

PVS1 + PM2 → Likely Pathogenic
LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
Gene diagram · NM_181523.2 · variants mapped to exon structure
PIK3R1 NM_181523.2
Fetching transcript structure from UCSC…
Applied criteria · 2 applied · 10 assessed
MetEvidence satisfies this criterion.
Not metEvaluated against available evidence; threshold not reached.
Not assessedApplies in principle, but no evidence was found to evaluate it.
N/ADoesn't apply to this variant type.
Applied · 2
Strength Supporting Moderate Strong Very strong
PVS1 very strong Pathogenic
Met (Very Strong): out-of-frame 25-nt deletion creates a premature stop (p.His450GlnfsTer22) within the VCEP c.917-c.1890 window, predicted to trigger nonsense-mediated decay.
CSPEC PVS1 Very Strong rule: premature stop codon between c.917 and c.1890 predicted to trigger NMD, with the exon present in all 3 biologically-relevant PIK3R1 transcripts, warrants PVS1 at default (Very Strong) strength.VariantValidator exonic position mapping places the deletion in exon 11 for GRCh37, GRCh38, and RefSeqGene (NG_012849.2) coordinate systems.pvs1_gene_context.json confirms PVS1 gene-level gate is 'eligible' because the CSPEC provides official PVS1 guidance for PIK3R1, establishing germline loss-of-function as a disease mechanism for PIK3R1-related immunodeficiency and SHORT syndrome (MONDO:1060136).
PM2 supporting Pathogenic
Met (Supporting): absent from gnomAD v4.1, below the VCEP <0.00000132 allele-frequency threshold.
The PIK3R1 VCEP PM2 rule requires total allele frequency <0.00000132 across all populations in gnomAD v4.1 and limits PM2 to supporting strength.The queried NM_181523.2:c.1350_1374del / GRCh38 deletion is absent from gnomAD v4.1, so its recorded total allele frequency is below the specified threshold.The same variant is also absent from gnomAD v2.1 and gnomAD-Canada v1.0.
Assessed · not applied · 2 not met · 8 not assessed
Pathogenic
PS2 Not assessed: no proband-level parental testing, maternity/paternity confirmation, or family-history data were available.
PS3 Not assessed: no functional assay data (kinase activity, protein binding, animal models) for this exact variant were available.
PS4 Not assessed: no proband phenotype scoring, case-control enrichment data, or unrelated affected individuals carrying this variant were available.
PP1 Not assessed: no affected relatives, pedigree, segregation results, or meiosis counts were available.
PP4 Not assessed: no qualifying proband with at least 10 VCEP phenotype points or documented exclusion of an alternative PIK3CD variant.
Benign
BA1 Not met: absent from gnomAD v4.1, below the BA1 >=0.00316 allele-frequency threshold.
BS1 Not met: absent from gnomAD v4.1, below the BS1 >=0.000316 allele-frequency threshold.
BS3 Not assessed: no normal-result functional assay data for this exact variant were available.
BS4 Not assessed: no pedigree or affected family members lacking the variant were available.
BP5 Not assessed: no documented cases where this variant coexisted with an alternative molecular cause of disease were available.
N/A · 16 PS1 · PM1 · PM3 · PM4 · PM5 · PM6 · PP2 · PP3 · PP5 · BS2 · BP1 · BP2 · BP3 · BP4 · BP6 · BP7
Research & evidence
Population frequency · supports pathogenic
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
Absent from gnomAD v4.1.
v2.1
Absent from gnomAD v2.1.
🇨🇦 CA
Absent from gnomAD-Canada v1.0.
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD v2.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD Canada 🇨🇦
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
ClinVar screenshot
ClinVar
This variant is absent from ClinVar.
SpliceAI screenshot
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.00).
Functional / OncoKB screenshot
Functional Likely Oncogenic
OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Loss-of-function; curated oncogenicity label: Likely Oncogenic.
OncoKB ↗
COSMIC screenshot
COSMIC
Cancer hotspots screenshot
Cancer hotspots
Somatic evidence Not in COSMIC / hotspots
COSMIC
This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant does not lie in a statistically significant hotspot.
Sources & reference links
9Sources
CSpec VCEP
ClinVar
gnomAD v2.1
gnomAD v4.1
gnomAD-Canada
SpliceAI
OncoKB
COSMIC
Cancer hotspots
Triaged references · 3 PMIDs not cited in assessment
25133428 ↗ A human immunodeficiency caused by mutations in the PIK3R1 gene. ONCOKB
25284480 ↗ Naturally occurring neomorphic PIK3R1 mutations activate the MAPK pathway, dictating therapeutic response to MAPK pathway inhibitors. ONCOKB
25488983 ↗ Heterozygous splice mutation in PIK3R1 causes human immunodeficiency with lymphoproliferation due to dominant activation of PI3K. ONCOKB